Fungi Vectored by the Bark Beetle Ips typographus Following Hibernation Under the Bark of Standing Trees and in the Forest Litter

Abstract

The bark beetle Ips typographus has different hibernation environments, under the bark of standing trees or in the forest litter, which is likely to affect the beetle-associated fungal flora. We isolated fungi from beetles, standing I. typographus-attacked trees, and forest litter below the attacked trees. Fungal identification was done using cultural and molecular methods. The results of the two methods in detecting fungal species were compared. Fungal communities associated with I. typographus differed considerably depending on the hibernation environment. In addition to seven taxa of known ophiostomoid I. typographus-associated fungi, we detected 18 ascomycetes and anamorphic fungi, five wood-decaying basidomycetes, 11 yeasts, and four zygomycetes. Of those, 14 fungal taxa were detected exclusively from beetles that hibernated under bark, and six taxa were detected exclusively from beetles hibernating in forest litter. The spruce pathogen, Ceratocystis polonica, was detected occasionally in bark, while another spruce pathogen, Grosmannia europhioides, was detected more often from beetles hibernating under the bark as compared to litter. The identification method had a significant impact on which taxa were detected. Rapidly growing fungal taxa, e.g. Penicillium, Trichoderma, and Ophiostoma, dominated pure culture isolations; while yeasts dominated the communities detected using molecular methods. The study also demonstrated low frequencies of tree pathogenic fungi carried by I. typographus during its outbreaks and that the beetle does not require them to successfully attack and kill trees.

High-Throughput Sequencing Reveals Drastic Changes in Fungal Communities in the Phyllosphere of Norway Spruce (Picea abies) Following Invasion of the Spruce Bud Scale (Physokermes piceae)

“…Although the source of inoculum for such fungi cannot be established, the possibility should not be excluded that P. piceae vector specific fungal community which may readily establish at the sites of damage. This would not be surprising as insect-fungi associations are common in nature [6,27,28]. Yet such information is not available for P. piceae, but would be of considerable practical importance as due to the ongoing climate change the impact of P. piceae can be expected to be even greater in the future.…”

Bark beetle-associated fungi in Fennoscandia with special emphasis on species of Ophiostoma and Grosmannia

“…Previous reports of Gr. pseudormiticum from Europe are limited (Kirschner 1998, Persson et al 2009). Graphium pseudormiticum is assumed to be of European origin (Morelet 1995), and Jacobs et al (2003) suggested that due to confusing taxonomy, the species might have been overlooked in previous surveys, and that it actually occurs in association with a variety of pine-infesting bark beetles in Europe.…”

Fungi associated with Ips acuminatus (Coleoptera: Curculionidae) in Ukraine with a special emphasis on pathogenicity of ophiostomatoid species

“…30 ml of Hagem agar medium supplemented with the antibiotic chloramphenicol (0.5%) and incubated at room temperature (ca. 21°C) in the dark (Persson et al, 2009). Petri dishes were checked daily for two months and outgrowing fungal mycelia were subcultured in new Petri dishes with fresh medium.…”

“…Isolation of DNA (without surface sterilisation) from the beetles (beetles were frozen, crushed and DNA was isolated separately from each individual), amplifi cation and sequencing of fungal ITS rRNA were carried out as described by Persson et al (2009). Amplifi cation by PCR was done in two steps: fi rstly using fungal specifi c primers NLC2 (GAGCTGATTCCCAAACAACTC) and NSA3 (AAACTCTGTCGTGCTGGGGATA) (Davydenko et al, 2014), and then in a second (nested) PCR using primers ITS1F and ITS4 as above.…”