Functional genomics in Trypanosoma brucei: A collection of vectors for the expression of tagged proteins from endogenous and ectopic gene loci

Kelly, Steven; Reed, Jennifer; Krämer, Susanne; Ellis, Louise; Webb, Helena; Sunter, Jack D.; Salje, Jeanne; Marinsek, Nina; Gull, Keith; Wickstead, Bill; Carrington, Mark

doi:10.1016/j.molbiopara.2007.03.012

Cited by 204 publications

(238 citation statements)

References 36 publications

Supporting

Mentioning

235

Contrasting

Order By: Relevance

“…A Letm1 gene fragment amplified using forward primer GGATCCGGTCAAGC-CTACCCGATACA (introduced BamHI site underlined) and reverse primer AGGCCTTCGGTAATTGCCTTCACTCC (HindIII site underlined) was cloned into the p2T7-177 vector, bearing opposing T7 polymerase promoters/tetracycline oper-ators and targeted to a transcriptionally silent part of the T. brucei genome (41), via the indicated restriction sites. For in situ C-terminal tagging of Letm1 with YFP, the full open reading frame (ORF) excluding the stop codon was PCR-amplified with the forward primer GGTACCATGTTGG CAGCAA-CGGGGTT (Acc65I restriction site underlined) and reverse primer GGATCCATTT TTTGCAATCACCTCTGAAGGCT (BamHI site underlined) and cloned into the p2937 vector, derived from the p2710 vector bearing the blasticidin resistance marker (42). The construct was linearized using the unique NcoI restriction site within the Letm1 ORF to yield homology flanks for integration into the endogenous locus.…”

Section: Methodsmentioning

confidence: 99%

Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis

Hashimi

McDonald

Stříbrná

et al. 2013

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background: Letm1 is a mitochondrial protein attributed disparate roles, including cation/proton antiport and translation. Results: Letm1 RNAi silencing in Trypanosoma brucei triggers swelling mitochondria and translation arrest that is ameliorated by chemical potassium/proton exchangers. Conclusion:The ancestral function of Letm1, to maintain mitochondrial potassium homeostasis, shows remarkable conservation. Significance: Results from diverged T. brucei provide a better understanding of Letm1 function throughout eukaryotes.

show abstract

Section: Methodsmentioning

confidence: 99%

Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis

Hashimi

McDonald

Stříbrná

et al. 2013

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Fusion constructs were assembled in plasmid vectors (44). For the HMGs (DMC1, Tb09.211.1210; HOP1, Tb10.70.1530; MND1, Tb11.02.3380; SPO11, Tb927.5.3760), the gene for enhanced YFP was fused to the N terminus of the endogenous ORF, whereas for PFR1 (Tb927.3.4290), a C-terminal fusion was used.…”

Section: Methodsmentioning

confidence: 99%

Identification of the meiotic life cycle stage of Trypanosoma brucei in the tsetse fly

Peacock

Ferris

Sharma

et al. 2011

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

123

149

View full text Add to dashboard Cite

Elucidating the mechanism of genetic exchange is fundamental for understanding how genes for such traits as virulence, disease phenotype, and drug resistance are transferred between pathogen strains. Genetic exchange occurs in the parasitic protists Trypanosoma brucei , T. cruzi , and Leishmania major , but the precise cellular mechanisms are unknown, because the process has not been observed directly. Here we exploit the identification of homologs of meiotic genes in the T. brucei genome and demonstrate that three functionally distinct, meiosis-specific proteins are expressed in the nucleus of a single specific cell type, defining a previously undescribed developmental stage occurring within the tsetse fly salivary gland. Expression occurs in clonal and mixed infections, indicating that the meiotic program is an intrinsic but hitherto cryptic part of the developmental cycle of trypanosomes. In experimental crosses, expression of meiosis-specific proteins usually occurred before cell fusion. This is evidence of conventional meiotic division in an excavate protist, and the functional conservation of the meiotic machinery in these divergent organisms underlines the ubiquity and basal evolution of meiosis in eukaryotes.

show abstract

“…Given the recent work on genetic exchange in T. brucei insect stages [58], such a system could extend our ability to study the trypanosome life cycle, except that few stage-specific promoters or transcription factors have been identified in trypanosomes. Finally, the use of an excisable marker cassette would be highly desirable when epitope-tagging endogenous loci, the main purpose of which is to maintain the native upstream and downstream regulatory regions, which is not possible with existing tagging approaches [59,60].…”

Section: Extensions Of Cre/loxpmentioning

confidence: 99%

CRE recombinase-based positive–negative selection systems for genetic manipulation in Trypanosoma brucei

Scahill

Pastar

Cross

2008

Molecular and Biochemical Parasitology

View full text Add to dashboard Cite

The limited repertoire of drug-resistance markers imposes a serious obstacle to genetic manipulation of Trypanosoma brucei. Here we describe experiments with a fusion protein that allows positive selection for genome integration followed by CRE recombinase-mediated excision of the marker cassette that can be selected by ganciclovir, although the excision event is so efficient that selection is not strictly necessary. We describe two variants of the tetracycline-inducible pLEW100-based CRE-expression vector that reduced its toxicity when stably integrated into the genome, and we demonstrate that transient transfection of circular pLEW100-CRE is highly efficient at catalyzing marker excision. We used this approach to delete the last two enzymes of the pyrimidine synthesis pathway, creating a cell line that is resistant to fluoroorotic acid, which would allow the same enzymes (PYR6-5) to be used as an alternative negative selectable marker.

show abstract

Functional genomics in Trypanosoma brucei: A collection of vectors for the expression of tagged proteins from endogenous and ectopic gene loci

Cited by 204 publications

References 36 publications

Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis

Trypanosome Letm1 Protein Is Essential for Mitochondrial Potassium Homeostasis

Identification of the meiotic life cycle stage of Trypanosoma brucei in the tsetse fly

CRE recombinase-based positive–negative selection systems for genetic manipulation in Trypanosoma brucei

Contact Info

Product

Resources

About