Functional Genomic Screening Reveals Splicing of the EWS-FLI1 Fusion Transcript as a Vulnerability in Ewing Sarcoma

Grohar, Patrick J.; Kim, Suntae; Rivera, Guillermo O. Rangel; Sen, Nirmalya; Haddock, Sara; Harlow, Matt L.; Maloney, Nichole; Zhu, Jianqiong; O'Neill, Michael C.; Jones, Tamara L.; Hüppi, Konrad; Grandin, Magdalena; Gehlhaus, Kristen; Klumpp‐Thomas, Carleen; Buehler, Eugen; Helman, Lee J.; Martin, Scott E.; Caplen, Natasha J.

doi:10.1016/j.celrep.2015.12.063

Cited by 40 publications

(45 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…22 breakpoints in EWSR1 intron 7 (TC71 and RD‐ES) exhibited no dependence on the expression of HNRNPH1. Furthermore, immunoprecipitation of HNRNPH1‐bound RNA indicated direct binding of HNRNPH1 to EWSR1 exon 8, and an in vitro binding assay showed HNRNPH1 binds G‐rich RNA sequences at the 3′ end of EWSR1 exon 8 (Grohar et al, ). Together, our results suggest that the inhibition of the EWSR1 exon exclusion event regulated by HNRNPH1 could block the expression of the EWS‐FLI1 fusion oncoprotein expressed in about a quarter to a third of cases of EWS.…”

Section: The Making Of a Fusion Transcript: Insights From A Functionamentioning

confidence: 99%

Fusion transcripts: Unexploited vulnerabilities in cancer?

2019

View full text Add to dashboard Cite

Gene fusions are an important class of mutations in several cancer types and include genomic rearrangements that fuse regulatory or coding elements from two different genes. Analysis of the genetics of cancers harboring fusion oncogenes and the proteins they encode have enhanced cancer diagnosis and in some cases patient treatment. However, the effect of the complex structure of fusion genes on the biogenesis of the resulting chimeric transcripts they express is not well studied. There are two potential RNA‐related vulnerabilities inherent to fusion‐driven cancers: (a) the processing of the fusion precursor messenger RNA (pre‐mRNA) to the mature mRNA and (b) the mature mRNA. In this study, we discuss the effects that the genetic organization of fusion oncogenes has on the generation of translatable mature RNAs and the diversity of fusion transcripts expressed in different cancer subtypes, which can fundamentally influence both tumorigenesis and treatment. We also discuss functional genomic approaches that can be utilized to identify proteins that mediate the processing of fusion pre‐mRNAs. Furthermore, we assert that an enhanced understanding of fusion transcript biogenesis and the diversity of the chimeric RNAs present in fusion‐driven cancers will increase the likelihood of successful application of RNA‐based therapies in this class of tumors.This article is categorized under:RNA Processing > RNA Editing and ModificationRNA Processing > Splicing Regulation/Alternative SplicingRNA in Disease and Development > RNA in Disease

show abstract

Section: The Making Of a Fusion Transcript: Insights From A Functionamentioning

confidence: 99%

Fusion transcripts: Unexploited vulnerabilities in cancer?

2019

View full text Add to dashboard Cite

show abstract

“…For RNAi studies, we purchased siRNAs from Thermo Fisher Scientific (Ambion) or Qiagen (Germantown, MD) and transfected cells using 20 nM siRNA complexed with RNAi‐Max (Thermo Fisher Scientific). To deplete EWS‐FLI1 expression, we used siRNAs we have validated previously that target either the EWSR1 (siEWSR1.1 5′‐GCCUCCCACUGGUUAUACUtt‐3′, Ambion, S4888) or the FLI1 (siFLI1.1 5′‐CAAACGAUCAGUAAGAAUAtt‐3′, Ambion, S5266) derived portions of the fusion transcript . To silence the expression of ATF , PHGDH , or SLC1A5 we used the following siRNAs: siATF4 5′‐CAGCGTTGCTGTAACCGACAA‐3′ (Qiagen, SI03019345); siPHGDH.1 5′‐CACGACAGGCTTGCTGAATGA‐3′ (Qiagen, SI00090384); siPHGDH.2 5′ ‐TGGGATGAAGACTATAGGGTA‐3′ (Qiagen, SI00090405); siSLC1A5.1 5′‐UAGGUGGUAGAGUAUGAGCga‐3′ (Ambion, S12916) siSLC1A5.2 5′‐AAAGAGUAAACCCACAUCCtc‐3′ (Ambion, S12918).…”

Section: Methodsmentioning

confidence: 99%

“…We collected ChIP‐seq data from a published study, and generated coverage density maps (tiled data files) by counting the number of reads that mapped to each 25 base pair (bp) window using Integrative Genomics Viewer (IGV) tools (http://software.broadinstitute.org/software/igv/). We performed ChIP‐PCR studies using the Magna‐ChIP Kit (Millipore, Billerica, MA) as per manufacturer's instructions and either an anti‐FLI1 antibody (ab15289, Abcam, Cambridge, MA) or normal rabbit IgG antibody (02‐6102, Thermo Fisher Scientific) overnight as described previously . Two independent experiments were performed, one in which we normalized samples to IgG antibody and one in which normalized samples to the percentage input DNA.…”

Section: Methodsmentioning

confidence: 99%

“…To deplete EWS-FLI1 expression, we used siRNAs we have validated previously that target either the EWSR1 (siEWSR1.1 5′-GCCUCCCA-CUGGUUAUACUtt-3′, Ambion, S4888) or the FLI1 (siFLI1.1 5′-CAAACGAUCAGUAAGAAUAtt-3′, Ambion, S5266) derived portions of the fusion transcript. 35 To silence the expression of ATF, PHGDH, or SLC1A5 we used the following siRNAs: siATF4 5′-CAGCGTTGCTG-TAACCGACAA-3′ (Qiagen, SI03019345); siPHGDH.1 5′-CACGA-CAGGCTTGCTGAATGA-3′ (Qiagen, SI00090384); siPHGDH.2 5′ -TGGGATGAAGACTATAGGGTA-3′ (Qiagen, SI00090405); siSLC1A 5.1 5′-UAGGUGGUAGAGUAUGAGCga-3′ (Ambion, S12916) siSLC 1A5.2 5′-AAAGAGUAAACCCACAUCCtc-3′ (Ambion, S12918). Figure S1A) and prepared poly-A selected RNA libraries that we sequenced on an Illumina HiSeq2000 (Illumina, San Diego, CA).…”

Section: Figure 1 Ews-fli1 Regulates the Expression Of Multiple Serinmentioning

confidence: 99%

See 1 more Smart Citation

EWS‐FLI1 reprograms the metabolism of Ewing sarcoma cells via positive regulation of glutamine import and serine‐glycine biosynthesis

Sen

Cross

Lorenzi

et al. 2018

Molecular Carcinogenesis

Self Cite

View full text Add to dashboard Cite

Ewing sarcoma (EWS) is a soft tissue and bone tumor that occurs primarily in adolescents and young adults. In most cases of EWS, the chimeric transcription factor, EWS‐FLI1 is the primary oncogenic driver. The epigenome of EWS cells reflects EWS‐FLI1 binding and activation or repression of transcription. Here, we demonstrate that EWS‐FLI1 positively regulates the expression of proteins required for serine‐glycine biosynthesis and uptake of the alternative nutrient source glutamine. Specifically, we show that EWS‐FLI1 activates expression of PHGDH, PSAT1, PSPH, and SHMT2. Using cell‐based studies, we also establish that EWS cells are dependent on glutamine for cell survival and that EWS‐FLI1 positively regulates expression of the glutamine transporter, SLC1A5 and two enzymes involved in the one‐carbon cycle, MTHFD2 and MTHFD1L. Inhibition of serine‐glycine biosynthesis in EWS cells impacts their redox state leading to an accumulation of reactive oxygen species, DNA damage, and apoptosis. Importantly, analysis of EWS primary tumor transcriptome data confirmed that the aforementioned genes we identified as regulated by EWS‐FLI1 exhibit increased expression compared with normal tissues. Furthermore, retrospective analysis of an independent data set generated a significant stratification of the overall survival of EWS patients into low‐ and high‐risk groups based on the expression of PHGDH, PSAT1, PSPH, SHMT2, SLC1A5, MTHFD2, and MTHFD1L. In summary, our study demonstrates that EWS‐FLI1 reprograms the metabolism of EWS cells and that serine‐glycine metabolism or glutamine uptake are potential targetable vulnerabilities in this tumor type.

show abstract

“…While some studies observe differences in malignancy between fusion types [29,30] , a European prospective trial found no prognostic significance between them [31] . Different fusion types were shown to have a different dependence on various proteins of the splicing machinery, so inhibition of splicing factors may have therapeutic value in some cases of EWS [32] .…”

Section: Chromosomal Translocationsmentioning

confidence: 99%

Molecular genetics of Ewing sarcoma, model systems and finding novel (immuno-) therapeutic targets

Ent¹,

Sand²,

Hogendoorn³

2018

JTGG

View full text Add to dashboard Cite

Ewing sarcoma (EWS) is a bone-and soft tissue tumour affecting primarily children and young adults. A quarter of patients present with metastases at the time of diagnosis and have a poor outlook in terms of overall survival. Efforts are made across the field to gain deeper insight in the genetics of this enigmatic neoplasm. EWS is characterized by presence of an oncogenic translocation gene, EWSR1-ETS. In addition, there are a limited number of known recurrent DNA copy number variations and mutations. Subsequent of the above, the epigenetic profile of EWS is subject of interest. In this review, we summarize the current available knowledge on the genetics underpinning EWS, explore the current knowledge of its epigenetic profile, discuss in vitro and in vivo model systems, and explore the unravelling knowledge of potential targets for treatment including recent insights into potential immunotherapy.

show abstract

Functional Genomic Screening Reveals Splicing of the EWS-FLI1 Fusion Transcript as a Vulnerability in Ewing Sarcoma

Cited by 40 publications

References 38 publications

Fusion transcripts: Unexploited vulnerabilities in cancer?

Fusion transcripts: Unexploited vulnerabilities in cancer?

EWS‐FLI1 reprograms the metabolism of Ewing sarcoma cells via positive regulation of glutamine import and serine‐glycine biosynthesis

Molecular genetics of Ewing sarcoma, model systems and finding novel (immuno-) therapeutic targets

Contact Info

Product

Resources

About