Functional Conservation of an AGAMOUS Orthologous Gene Controlling Reproductive Organ Development in the Gymnosperm Species Taxus chinensis var. mairei

Liu, Zhixiong; Xiong, Hongkai; Li, Laiyun; Fei, Yong-Jun

doi:10.1007/s12374-017-0154-4

Cited by 15 publications

(14 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similar results were obtained for the overexpression of AG orthologs using transgenic approaches in other plant species as well, such as tobacco [19][20][21][22], tomato [23] and petunia [24]. In addition, the endogenous AG gene function of specifying stamen and carpel identities in the Arabidopsis ag mutant could be partially or fully compensated by ectopic expression of AG orthologs from other plant species, such as MastAG [16], FaesAG [25] and TcAG [26]. These findings indicate that AG orthologs can also be responsible for the formation of reproductive organs.…”

Section: Introductionsupporting

confidence: 74%

Ectopic expression of CsMADS24, an AGAMOUS ortholog from cucumber, causes homeotic conversion of sepals into carpels in transgenic arabidopsis plants

Zhou

et al. 2019

ARCH BIOL SCI BELGRA

View full text Add to dashboard Cite

The floral homeotic C-function MADS gene AGAMOUS (AG) in Arabidopsis plays crucial roles in specifying stamen and carpel identities as well as determining floral meristem. However, there have been only a few studies of floral homeotic C-function genes in cucumber thus far. In the present study, CsMADS24, a putative AG ortholog from cucumber, was isolated and characterized. Sequence analysis and protein sequence alignment revealed that the deduced CsMADS24 protein contained the typical MIKC structure and the N-terminal extension, as well as two highly conserved AG motifs (I and II). Phylogenetic analysis showed that CsMADS24 fell into the clade of core eudicots, while being distant from the AG orthologs of basal eudicots, monocots and gymnosperms. Expression analysis by RT-PCR showed that CsMADS24 was exclusively expressed in female flower buds. In situ hybridization revealed that CsMADS24 expression was only detected in the carpels. Functional analyses indicated that the sepals were partly converted into carpelloid-like structures in 35S::35S::CsMADS24 transgenic plants. In addition, earlier flowering and delayed floral organ abscission during the development of siliques were also observed in transgenic Arabidopsis. Our findings demonstrate that the AG ortholog plays an exclusive role in carpel specification of cucumber, providing a basis for revealing the mechanisms of reproductive development in cucumber.

show abstract

Section: Introductionsupporting

confidence: 74%

Ectopic expression of CsMADS24, an AGAMOUS ortholog from cucumber, causes homeotic conversion of sepals into carpels in transgenic arabidopsis plants

Zhou

et al. 2019

ARCH BIOL SCI BELGRA

View full text Add to dashboard Cite

show abstract

“…Full-length FaesAP1 cDNA amplified followed by 3′- and 5′-RACE with the forward primer TFaesAP1F (5′- AGGATCCACAGAAGAGCAAAGAAGAAG-3′) and the reverse primer TFaesAP1R (5′- TCATACGTAGCAAGTCTGGTTTCACAC -3′) according to the protocol described by Li et al [18]. Sequence alignments and phylogenetic analysis of FaesAP1 were referenced the method described by Liu et al [31]. Putative FaesAP1 protein sequences and various AP1/FUL-like proteins were selected for Phylogenetic trees from NCBI Genbank (Table S1).…”

Section: Methodsmentioning

confidence: 99%

“…Pin and thrum flowers buds of F. esculentum ‘Beizaosheng’ were sampled at sequential developmental stages, and subsequently fixed, dehydrated, cleared, infiltrated, embedded into paraffin block, serially sectioned, and then sections were stained and observed with photomicrographs taken according to Liu et al [31].…”

Section: Methodsmentioning

confidence: 99%

Ectopic Expression of a Fagopyrum esculentum APETALA1 Ortholog only Rescues Sepal Development in Arabidopsis ap1 Mutant

Liu

Fei

Zhang

et al. 2019

IJMS

View full text Add to dashboard Cite

Fagopyrum esculentum (Polygonaceae: Caryophyllales) exhibits an undifferentiated perianth comprising five showy tepals, which does not completely correspond to the perianth differentiated into typical sepals and petals in most core eudicots. In Arabidopsis, the APETALA1 (AP1) gene is involved in specifying sepals and petals development. Here we isolated AP1 ortholog, FaesAP1, and a 2.2kb FaesAP1 promoter (pFaesAP1) from F. esculentum. FaesAP1 expression is mainly detectable in all floral organs and maintains at a high level when tepals elongate rapidly both in pin and thrum flowers. Moreover, the GUS reporter gene driven by pFaesAP1 was activated in flowers where the sepals were intense, but the petals very weak or absent. Additionally, FaesAP1 ectopic expression in Arabidopsis ap1-10 mutant rescues sepal development fully, obviously prompting early flowering, but failing to complement petal development. In this study, evidence was provided that the showy tepals in the F. esculentum are homologs to core eudicots sepals. Furthermore, these findings show a different perianth identity program in Caryophyllales, suggesting that AP1 orthologs involved in petal development may evolve independently across different clades of core eudicots. Our results also suggest that FaesAP1 holds potential for biotechnical engineering to develop early flowering varieties of F. esculentum.

show abstract

“…The samples for histological observations were collected and fixed in FAA (38% formaldehyde: acetic acid: 70% ethanol = 1:1:18, by volume). Samples were dehydrated in a graded ethanol series, cleared in a xylene series, infiltrated with molten paraffin, and then embedded into a paraffin block according to Liu et al [20]. The embedded samples were serially sectioned at a thickness of 8 µm with a Leica RM2235 rotary microtome.…”

Section: Histological Analysismentioning

confidence: 99%

Somatic Embryogenesis and Plant Regeneration from Cotyledon and Hypocotyl Explants of Fagopyrum esculentum Moench lpls Mutant

et al. 2019

Self Cite

View full text Add to dashboard Cite

Buckwheat (Fagopyrum esculentum, Family Polygonaceae) is an annual pseudo-cereal crop with healing benefits. However, the genetic improvement of common buckwheat has achieved only limited success, mainly due to buckwheat’s dimorphic flowers and heteromorphic self-incompatibility. Here, we develop a useful protocol for indirect somatic embryogenesis and subsequent plant regeneration from hypocotyl explants of F. esculentum. Firstly, the initial calli of hypocotyl explants were induced on Murashige and Skoog (MS) basal medium containing 2.0 mgL−1 2,4-D and 1.5 mgL−1 6-BA for 30 days culture, and then the yellowish white friable embryogenic calli were developed when the initial calli were transferred to fresh MS basal medium supplemented with 1.0 mgL−1 6-BA and 0.5 mgL−1 thidiazuron (TDZ)two to three times subculture at 40–60 days intervals. Subsequently, the somatic embryos were able to germinate from embryogenic callus sub-cultured on MS basal medium containing 1.0 mgL−1 6-BA and 0.5 mgL−1 TDZ with 15% potato puree for 20 days subculture. Finally, maximum mean percentage (75.75%) of somatic embryo-derived plants were obtained when the mature somatic embryos were transferred to MS basal medium without growth regulators for 40 days culture. Our result provides a useful protocol for plant regeneration and SE from hypocotyl explants of F. esculentum.

show abstract

Functional Conservation of an AGAMOUS Orthologous Gene Controlling Reproductive Organ Development in the Gymnosperm Species Taxus chinensis var. mairei

Cited by 15 publications

References 39 publications

Ectopic expression of CsMADS24, an AGAMOUS ortholog from cucumber, causes homeotic conversion of sepals into carpels in transgenic arabidopsis plants

Ectopic expression of CsMADS24, an AGAMOUS ortholog from cucumber, causes homeotic conversion of sepals into carpels in transgenic arabidopsis plants

Ectopic Expression of a Fagopyrum esculentum APETALA1 Ortholog only Rescues Sepal Development in Arabidopsis ap1 Mutant

Somatic Embryogenesis and Plant Regeneration from Cotyledon and Hypocotyl Explants of Fagopyrum esculentum Moench lpls Mutant

Contact Info

Product

Resources

About