Functional characterization of the K257R and G319E-hGALE alleles found in patients with ostensibly peripheral epimerase deficiency galactosemia

Wasilenko, Jamie; Lucas, Mary E.; Thoden, James B.; Holden, Hazel M.; Fridovich‐Keil, Judith L.

doi:10.1016/j.ymgme.2004.09.003

Cited by 26 publications

(24 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

Section: Gale-1(pv18) Is Impaired In Udp-sugar Levelsmentioning

confidence: 91%

“…Changes in UDP-glc and UDP-glcNAc are not significant. Interestingly, increased UDP-gal levels have been also observed in human patients (Walter et al 1999) as in the yeast model for galactosemia type III (Quimby et al 1997;Ross et al 2004;Wasilenko et al 2005;Chhay et al 2008).gale-1(pv18) confers hypersensitivity to galactoseOne of the symptoms of galactosemia is intolerance to a galactose-rich diet, which has been attributed to the accumulation of toxic galactose metabolism intermediates (Walter et al 1999;Ross et al 2004;Sanders et al 2010;McCorvie et al 2011). We observed that gale-1(pv18) worms cultivated in a high concentration of galactose develop slowly, indicating a hypersensitivity to galactose, whereas wild-type worms or gale-1(pv18) carrying a construction with gale-1(+) are not affected ( Figure 4A).…”

mentioning

confidence: 94%

See 1 more Smart Citation

Developmental Defects in a Caenorhabditis elegans Model for Type III Galactosemia

et al. 2014

View full text Add to dashboard Cite

Type III galactosemia is a metabolic disorder caused by reduced activity of UDP-galactose-4-epimerase, which participates in galactose metabolism and the generation of various UDP-sugar species. We characterized gale-1 in Caenorhabditis elegans and found that a complete loss-of-function mutation is lethal, as has been hypothesized for humans, whereas a nonlethal partial loss-offunction allele causes a variety of developmental abnormalities, likely resulting from the impairment of the glycosylation process. We also observed that gale-1 mutants are hypersensitive to galactose as well as to infections. Interestingly, we found interactions between gale-1 and the unfolded protein response.G ALACTOSE is universally metabolized by three conserved enzymes that constitute the Leloir pathway ( Figure 1) (Holden et al. 2003). UDP-galactose-4-epimerase (GALE) participates in the third step of the galactose metabolism pathway, catalyzing the interconversion of UDP-galactose (UDP-gal) and UDP-glucose (UDP-glc) and in some species, including humans, also the interconversion of UDP-N-acetylgalactosamine (UDP-galNAc) and UDP-N-acetylglucosamine (UDP-glcNAc) (Figure 1) (Maley and Maley 1959;Piller et al. 1983;Kingsley et al. 1986;Wohlers et al. 1999). Thus, GALE is essential not only to use galactose as an energy source but also to produce the different species of UDP sugars required for the glycosylation of proteins and lipids.In humans, mutations in GALE result in an autosomal recessive disorder known as type III galactosemia (OMIM #230350) (Fridovich-Keil 2006;Timson 2006), a rare disease characterized by the inability to metabolize galactose with symptoms that can include early onset cataracts, liver damage, deafness, and mental retardation (Walter et al. 1999). These symptoms are thought to occur as a result of the accumulation of intermediary galactose metabolites and the reduction of UDP-sugar species, which are needed for glycosylation. Other types of galactosemia are treated with a galactose-free diet. However, because of the dual role of GALE, patients with type III galactosemia are recommended to follow a galactoserestricted diet to avoid UDP-gal deficiency. This diet only partially alleviates the severe symptoms of galactosemia type III (Walter et al. 1999), and it has been proposed that patients receive UDP-galNAc as an additional treatment (Kingsley et al. 1986).Traditional model systems to study type III galactosemia include yeast, which does not exhibit the interconversion of UDP-N acetylgalactosamine and UDP-N acetylglucosamine (Schulz et al. 2004), and cell lines, such as human fibroblasts and the ldlD cell line derived from Chinese hamster ovaries. The latter exhibits a complete loss of GALE activity, resulting in the abnormal processing of both N-and O-linked glycoproteins (Kingsley et al. 1986;Krieger et al. 1989;Slepak et al. 2007). Recently, the first multicellular model for this disease was generated in Drosophila, in which the deletion of GALE caused a lethal phenotype (Sanders et al. 2010). In t...

show abstract

Section: Gale-1(pv18) Is Impaired In Udp-sugar Levelsmentioning

confidence: 91%

mentioning

confidence: 94%

Developmental Defects in a Caenorhabditis elegans Model for Type III Galactosemia

et al. 2014

View full text Add to dashboard Cite

show abstract

“…The primers used to generate alleles S81R, T150M and P293L were hGALE.S81Rf1 (5 ¶-CTCTT CAAAAAGTACAGGTTTATGGCGGTCATC-3 ¶) with hGALE.S81Rr1 (5 ¶-GATGACCGCCATAAA CCTGTACTTTTTGAAGAG-3 ¶), hGALET150Mf1 (5 ¶-CTTGATGAGGCCCACCCCATGGGTGGTTG TACCAACCCT-3 ¶) with hGALET150Mr1 (5 ¶-AGGG TTGGTACAACCACCCATGGGGTGGGCCT CATCAAG -3 ¶), and hGALEP293Lf1 (5 ¶-GCCTCTG GGAAGAAGATCCTGTACAAGGTGGTGG CACGG -3 ¶) with hGALEP293Lr1 (5 ¶-CCGTGCC A C C A C C T T G T A C A G G A T C T T C T T C C C A G AGGC-3 ¶), respectively. Recreation of the mutation G319E has been described previously (Wasilenko et al 2005). After confirmation by DNA sequencing of the entire open reading frame, each allele and the wild-type allele was then subcloned into each of the low-copy number (CEN) expression plasmids, pMM22 and pMM33, using the enzymes EcoRI and SalI.…”

Section: Plasmids and Yeast Strainsmentioning

confidence: 99%

“…The resulting plasmid constructs, along with their corresponding negative controls (no hGALE), are listed in Table 1. Pairs of plasmids representing the desired allele combinations were co-transformed into JFy3835, a previously described null-background haploid strain of S. cerevisiae (Wasilenko et al 2005). The resulting yeast strains are listed in Table 2.…”

Section: Plasmids and Yeast Strainsmentioning

confidence: 99%

“…The use of budding yeast S. cerevisiae to assess the effects of mutations associated with type III galactosaemia is now well-established (Quimby et al 1997;Wasilenko et al 2005;Wohlers and Fridovich-Keil 2000;Wohlers et al 1999). Deletion of the S. cerevisiae gene GAL10 (the GALE/GALM protein) not only prevents growth under conditions where galactose is the sole carbon source, it also prevents growth when it is added in trace quantities (e.g.…”

Section: Structural Consequences Of the Mutationsmentioning

confidence: 99%

See 1 more Smart Citation

Analysis of UDP‐galactose 4′‐epimerase mutations associated with the intermediate form of type III galactosaemia

Chhay

Vargas

McCorvie

et al. 2008

J of Inher Metab Disea

View full text Add to dashboard Cite

Type III galactosaemia is a hereditary disease caused by reduced activity in the Leloir pathway enzyme, UDP-galactose 4'-epimerase (GALE). Traditionally, the condition has been divided into two forms-a mild, or peripheral, form and a severe, or generalized, form. Recently it has become apparent that there are disease states which are intermediate between these two extremes. Three mutations associated with this intermediate form (S81R, T150M and P293L) were analysed for their kinetic and structural properties in vitro and their effects on galactose-sensitivity of Saccharomyces cerevisiae cells that were deleted for the yeast GALE homologue Gal10p. All three mutations result in impairment of the kinetic parameters (principally the turnover number, k (cat)) compared with the wild-type enzyme. However, the degree of impairment was mild compared with that seen with the mutation (V94M) associated with the generalized form of epimerase deficiency galactosaemia. None of the three mutations tested affected the ability of the protein to dimerize in solution or its susceptibility to limited proteolysis in vitro. Finally, in the yeast model, each of the mutated patient alleles was able to complement the galactose-sensitivity of gal10Delta cells as fully as was the wild-type human allele. Furthermore, there was no difference from control in metabolite profile following galactose exposure for any of these strains. Thus we conclude that the subtle biochemical and metabolic abnormalities detected in patients expressing these GALE alleles likely reflect, at least in part, the reduced enzymatic activity of the encoded GALE proteins.

show abstract

Galactose Epimerase Deficiency: Expanding the Phenotype

et al. 2017

View full text Add to dashboard Cite

Galactose epimerase deficiency is an inborn error of metabolism due to uridine diphosphate-galactose-4'-epimerase (GALE) deficiency. We report the clinical presentation, genetic and biochemical studies in two siblings with generalized GALE deficiency.Patient 1: The first child was born with a dysmorphic syndrome. Failure to thrive was noticed during the first year. Episodes of heart failure due to dilated cardiomyopathy, followed by liver failure, occurred between 12 and 42 months. The finding of a serum transferrin isoelectrofocusing (IEF) type 1 pattern led to the suspicion of a congenital disorder of glycosylation (CDG). Follow-up disclosed psychomotor disability, deafness, and nuclear cataracts.Patient 2: The sibling of patient 1 was born with short limbs and hip dysplasia. She is deceased in the neonatal period due to intraventricular hemorrhage in the context of liver failure. Investigation disclosed galactosuria and normal transferrin glycosylation.Next-generation sequence panel analysis for CDG syndrome revealed the previously reported c.280G>A (p.[V94M]) homozygous mutation in the GALE gene. Enzymatic studies in erythrocytes (patient 1) and fibroblasts (patients 1 and 2) revealed markedly reduced GALE activity confirming generalized GALE deficiency. This report describes the fourth family with generalized GALE deficiency, expanding the clinical spectrum of this disorder, since major cardiac involvement has not been reported before.

show abstract

Functional characterization of the K257R and G319E-hGALE alleles found in patients with ostensibly peripheral epimerase deficiency galactosemia

Cited by 26 publications

References 18 publications

Developmental Defects in a Caenorhabditis elegans Model for Type III Galactosemia

Developmental Defects in a Caenorhabditis elegans Model for Type III Galactosemia

Analysis of UDP‐galactose 4′‐epimerase mutations associated with the intermediate form of type III galactosaemia

Galactose Epimerase Deficiency: Expanding the Phenotype

Contact Info

Product

Resources

About