Functional characterization of human Kindlin-2 core promoter identifies a key role of SP1 in Kindlin-2 transcriptional regulation

Abstract

Kindlin-2 is a recently identified FERM and PH domain containing integrin interacting protein. Kindlin-2 is ubiquitously expressed in normal tissues. So far, much effort has been spent exploring the functional aspects of Kindlin-2. However, the transcriptional regulation of Kindlin-2 has not yet been investigated. In this study we identified and functionally characterized the promoter of the human Kindlin-2 gene. We show that the core promoter of Kindlin-2 is a 39 base pair long GC rich fragment located −122/-83 upstream of the Kindlin-2 transcription start site. Functional characterization of this core promoter region by both in silico as well as in vitro/in vivo analysis shows that the transcription factor SP1 plays an important role in regulation of Kindlin-2 expression.

A feedback regulation between Kindlin‐2 and GLI1 in prostate cancer cells

“…To unravel whether GLI1 downregulates Kindlin‐2 through inhibiting the transcriptional activity of Kindlin‐2 promoter, we cloned a nearly 3 kb genomic sequence covering the −1565 to +1334 region of human Kindlin‐2 gene as described before [21] (Fig. 3 A), which referred to as Kindlin‐2 full length (FL) promoter in the following text.…”

“…Human Kindlin‐2 full length cDNA was cloned from prostate cancer cDNA library (Clontech) into pCMV 3× Flag vector as reported [21] Flag‐GLI1 plasmid was prepared as described in [22]. Kindlin‐2 promoter full length sequence (−1565 to +1334) was prepared as described in [21], and the different truncation forms of Kindlin‐2 were cloned into pGL4.21‐null vector (Promega) using the following primers: fragment −241 to +293: Forward primer: 5′‐CTCGAGCTTCATTTCCATAA, Reverse primer: 5′‐AAGCTTTAGCGGACCGCGGAGGGCTTCAC‐3′; fragment −207 to +293: Forward primer: 5′‐CTCGAGGCCGCGCCCCCCGCCACC‐3′, Reverse primer: 5′‐AAGCTTTAGCGGACCGCGGAGGGCTTCAC‐3′; fragment −195 to +293: Forward primer: 5′‐CTCGAGCCGCCACCCCCGCGCCGC‐3′, Reverse primer: 5′‐AAGCTTTAGCGGACCGCGGAGGGCTTCAC‐3′; fragment −77 to +293: Forward primer: 5′‐CTCGAGAGGGCAGCTCTGCGGGCGGCGAA‐3′, Reverse primer: 5′‐AAGCTTTAGCGGACCGCGGAGGGCTTCAC‐3′; Kindlin‐2 polyclonal antibody was prepared as described in [9], mouse monoclonal antibodies for GLI1(D‐1), Bcl‐2(N‐19) and Bax(B‐9) were purchased from Santa Cruz Biotechnology Inc. (CA, USA). Rabbit polyclonal antibody for PCNA was the product of Lab Vision (Fremont, CA, USA), and mouse monoclonal antibody for Actin was purchased from Beijing Zhongshan Inc. (China).…”

Kindlin-2 siRNA inhibits vascular smooth muscle cell proliferation, migration and intimal hyperplasia via Wnt signaling

“…Interactions between VSMCs and the ECM regulate these processes through binding of the integrin family of cell adhesion receptors (2). A key mediator of integrin signaling is kindlin-2, a recently discovered family of evolutionarily conserved four point one protein, ezrin, radixin and moesin (FERM) domain-containing proteins that binds directly to the cytoplasmic tails of β1 and β3 integrins (3)(4)(5). Kindlin-2 is essential for integrin clustering and activation, and regulates cell adhesion and directed migration by guiding the formation and maturation of focal adhesions (FA) and the organization of the cytoskeleton (6).…”

“…Kindlin-2 is essential for integrin clustering and activation, and regulates cell adhesion and directed migration by guiding the formation and maturation of focal adhesions (FA) and the organization of the cytoskeleton (6). Due to its essential role in integrin activation, kindlin-2 is involved in many important physiological processes, including heart development, cell migration and cancer progression (4,7). In mice, the loss of kindlin-2 causes peri-implantation lethality resulting from detachment of the endoderm and epiblast from the basement membrane as a consequence of diminished levels of β1-integrin and also of β1-integrin activation (8).…”