Functional analysis of the porcine USP18 and its role during porcine arterivirus replication

Aït-Ali, Tahar; Wilson, Alastair; Finlayson, Heather; Carré, Wilfrid; Ramaiahgari, Sreenivasa; Westcott, David G.; Waterfall, Martin; Frossard, Jean-Pierre; Baek, Kwang‐Hyun; Drew, Trevor W.; Bishop, Stephen; Archibald, Alan

doi:10.1016/j.gene.2009.02.021

Cited by 12 publications

(12 citation statements)

References 36 publications

(46 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1A). In contrast, USP18-V5 and USP18DN-V5 proteins were only detected in the presence of a cell-permeable proteosome degradation inhibitor MG132 as described earlier by Ait-Ali et al (2009) (Fig. 1B).…”

supporting

confidence: 72%

“…The Cys-box has putative transmembrane helices and a conserved putative active-site cysteine at cys64, which is essential for the catalytic property of USP18 (Quesada et al, 2004). The mutant version of USP18 (USP18DN) lacks the Cys-box (Supplemental data 1) and is thus unlikely to retain any significant proteolytic activity as demonstrated previously (Ait-Ali et al, 2009). For functional analysis, USP18 and USP18DN cDNAs were PCR-amplified from pcDNA3.1D/V5-His-USP18 and pcDNA3.1D/V5-His-USP18mut (Ait-Ali et al, 2009) with forward primer TAACCGGTATAGGGAGACCCAAGC and reverse primer GATGTACACGCGTAGAATCGAGACC.…”

mentioning

confidence: 89%

“…The mutant version of USP18 (USP18DN) lacks the Cys-box (Supplemental data 1) and is thus unlikely to retain any significant proteolytic activity as demonstrated previously (Ait-Ali et al, 2009). For functional analysis, USP18 and USP18DN cDNAs were PCR-amplified from pcDNA3.1D/V5-His-USP18 and pcDNA3.1D/V5-His-USP18mut (Ait-Ali et al, 2009) with forward primer TAACCGGTATAGGGAGACCCAAGC and reverse primer GATGTACACGCGTAGAATCGAGACC. PCR products were cloned into the pLenti6V5-D-TOPO expression vector (Invitrogen, UK) to generate the expression constructs USP18 and USP18DN tagged with V5-epitope.…”

mentioning

confidence: 89%

See 2 more Smart Citations

USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-κB p65 and p50 in MARC-145 cells

Lillico

Barnett

et al. 2012

Virus Research

Self Cite

View full text Add to dashboard Cite

Although the functions of porcine respiratory and reproductive syndrome virus (PRRSV) proteins are increasingly understood, the roles of host factors in modifying infection are less well understood. Growing evidence places deubiquitination at the core of a multitude of regulatory processes, ranging from cell growth to innate immune response and health, such as cancer, degenerative and infectious diseases. This report provides further information on the functional role of the porcine ubiquitin-specific peptidase 18 (USP18) during innate immune responses to PRRSV. We have shown that constitutive overexpression of the porcine USP18 in MARC-145 cells restricts PRRSV growth, at least in part via early activation of NF-κB. Viral growth of PRRSV may be perturbed by increasing and decreasing nuclear translocation of p65 and p50, respectively. Our data highlight USP18 as a host restriction factor during innate immune response to PRRSV.

show abstract

supporting

confidence: 72%

mentioning

confidence: 89%

mentioning

confidence: 89%

See 1 more Smart Citation

USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-κB p65 and p50 in MARC-145 cells

Lillico

Barnett

et al. 2012

Virus Research

Self Cite

View full text Add to dashboard Cite

show abstract

“…Previous research reported that the NS1 gene of the type B influenza virus directly inhibited E1 activity in ISG15 conjugation, and the ISG15 system, which induces IFN-␣/␤ for antiviral response, was also inhibited (52). USP18 inhibits a signaling pathway that induces regulation of the ISRE promoter, and the IFN response is downregulated by this process (1). Induction of USP18 is considered advantageous for viruses to survive in hosts.…”

Section: Discussionmentioning

confidence: 99%

Identification of Host Genes Linked with the Survivability of Chickens Infected with Recombinant Viruses Possessing H5N1 Surface Antigens from a Highly Pathogenic Avian Influenza Virus

Uchida

Watanabe

Takemae

et al. 2012

J Virol

View full text Add to dashboard Cite

Seventeen recombinant viruses were generated by a reverse genetic technique to elucidate the pathogenicity of highly pathogenic avian influenza viruses (HPAIVs) in chickens. The recombinant viruses generated possessed hemagglutinin (HA) and neuraminidase (NA) genes from an HPAIV. Other segments were combinations of the genes from an HPAIV and two low-pathogenic avian influenza viruses (LPAIVs) derived from chicken (

show abstract

“…The expression of ACOX3 and ENPEP genes were not significantly different between either uninfected or infected DPL and DLY pigs, suggesting that they are not related to PRRSV infection. Studies demonstrated that overexpression of the porcine USP18 leads to reduced replication and/or growth of PRRSV [47] and USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-κB p65 and p50 in MARC-145 cells [48]. In this study, we also noted a slight increase of USP18 mRNA expression level in uninfected DPL pigs compared to uninfected DLY pigs and significantly higher expression level of USP18 gene in infected DPL than that in infected DLY pigs, implying that it also plays an important role in the resistance of DPL pigs to PRRSV infection (Figure 4G).…”

Section: Discussionmentioning

confidence: 99%

Genome-Wide Gene Expression Profiles in Lung Tissues of Pig Breeds Differing in Resistance to Porcine Reproductive and Respiratory Syndrome Virus

et al. 2014

View full text Add to dashboard Cite

Porcine reproductive and respiratory syndrome (PRRS) caused by PRRS virus (PRRSV) is an infectious disease characterized by severe reproductive deficiency in pregnant sows, typical respiratory symptoms in piglets, and high mortality rate of piglets. In this study, we employed an Affymetrix microarray chip to compare the gene expression profiles of lung tissue samples from Dapulian (DPL) pigs (a Chinese indigenous pig breed) and Duroc×Landrace×Yorkshire (DLY) pigs after infection with PRRSV. During infection with PRRSV, the DLY pigs exhibited a range of clinical features that typify the disease, whereas the DPL pigs showed only mild signs of the disease. Overall, the DPL group had a lower percentage of CD4+ cells and lower CD4+/CD8+ratios than the DLY group (p<0.05). For both IL-10 and TNF-α, the DLY pigs had significantly higher levels than the DPL pigs (p<0.01). The DLY pigs have lower serum IFN-γ levels than the DPL pigs (p<0.01). The serum IgG levels increased slightly from 0 dpi to 7 dpi, and peaked at 14 dpi (p<0.0001). Microarray data analysis revealed 16 differentially expressed (DE) genes in the lung tissue samples from the DLY and DPL pigs (q≤5%), of which LOC100516029 and LOC100523005 were up-regulated in the PRRSV-infected DPL pigs, while the other 14 genes were down-regulated in the PRRSV-infected DPL pigs compared with the PRRSV-infected DLY pigs. The mRNA expression levels of 10 out of the 16 DE genes were validated by real-time quantitative RT-PCR and their fold change was consistent with the result of microarray data analysis. We further analyzed the mRNA expression level of 8 differentially expressed genes between the DPL and DLY pigs for both uninfected and infected groups, and found that TF and USP18 genes were important in underlying porcine resistance or susceptibility to PRRSV.

show abstract

Functional analysis of the porcine USP18 and its role during porcine arterivirus replication

Cited by 12 publications

References 36 publications

USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-κB p65 and p50 in MARC-145 cells

USP18 restricts PRRSV growth through alteration of nuclear translocation of NF-κB p65 and p50 in MARC-145 cells

Identification of Host Genes Linked with the Survivability of Chickens Infected with Recombinant Viruses Possessing H5N1 Surface Antigens from a Highly Pathogenic Avian Influenza Virus

Genome-Wide Gene Expression Profiles in Lung Tissues of Pig Breeds Differing in Resistance to Porcine Reproductive and Respiratory Syndrome Virus

Contact Info

Product

Resources

About