Functional analysis of a novel de novo variant in PPP5C associated with microcephaly, seizures, and developmental delay

Abstract

We describe a proband evaluated through the Undiagnosed Diseases Network (UDN) who presented with microcephaly, developmental delay, and refractory epilepsy with a de novo p.Ala47Thr missense variant in the protein phosphatase gene, PPP5C. This gene has not previously been associated with a Mendelian disease, and based on the population database, gnomAD, the gene has a low tolerance for loss-of-function variants (pLI=1, o/e=0.07). We functionally evaluated the PPP5C variant in C. elegans by knocking the variant into the orthologous gene, pph-5, at the corresponding residue, Ala48Thr. We employed assays in three different biological processes where pph-5 was known to function through opposing the activity of genes, mec-15 and sep-1. We demonstrated that, in contrast to control animals, the pph-5 Ala48Thr variant suppresses the neurite growth phenotype and the GABA signaling defects of mec-15 mutants, and the embryonic lethality of sep-1 mutants. The Ala48Thr variant did not display dominance and behaved similarly to the reference pph-5 null, indicating that the variant is likely a strong hypomorph or complete loss-of-function. We conclude that pph-5 Ala48Thr is damaging in C. elegans. By extension in the proband, PPP5C p.Ala47Thr is likely damaging, the de novo dominant presentation is consistent with haploinsufficiency, and the PPP5C variant is likely responsible for one or more of the proband's phenotypes.

Dominant negative variants in KIF5B cause osteogenesis imperfecta via down regulation of mTOR signaling

“…elegans genome editing. unc-116 edits were generated as previously described [77]. In brief, VC2010 adults were injected with Cas9 (IDT 1081060), tracrRNA (IDT 1072533), crRNA targeting sequence GCATATGGACAAACATCTTC (IDT CRISPR-Cas9 sgRNA), single-stranded DNA oligonucleotide repair template (IDT), and dpy-10 crRNA and repair template (the co-conversion marker) [78,79].…”