Function of Torsin AAA+ ATPases in Pseudorabies Virus Nuclear Egress

Abstract

Newly assembled herpesvirus nucleocapsids traverse the intact nuclear envelope by a vesicle-mediated nucleo-cytoplasmic transport for final virion maturation in the cytoplasm. For this, they bud at the inner nuclear membrane resulting in primary enveloped particles in the perinuclear space (PNS) followed by fusion of the primary envelope with the outer nuclear membrane (ONM). While the conserved viral nuclear egress complex orchestrates the first steps, effectors of fusion of the primary virion envelope with the ONM are still mostly enigmatic but might include cellular proteins like SUN2 or ESCRT-III components. Here, we analyzed the influence of the only known AAA+ ATPases located in the endoplasmic reticulum and the PNS, the Torsins (Tor), on nuclear egress of the alphaherpesvirus pseudorabies virus. For this overexpression of wild type and mutant proteins as well as CRISPR/Cas9 genome editing was applied. Neither single overexpression nor gene knockout (KO) of TorA or TorB had a significant impact. However, TorA/B double KO cells showed decreased viral titers at early time points of infection and an accumulation of primary virions in the PNS pointing to a delay in capsid release during nuclear egress.Cells 2020, 9, 738 2 of 19 genome at early stages of infection. Traffic into and out of the nucleus is thought to occur exclusively through NPCs (reviewed in Adam [3], Knockenhauer and Schwartz [4]). Interestingly, herpesvirus nucleocapsids are translocated through the nuclear envelope (NE) by a vesicle-mediated process designated as nuclear egress (reviewed in [5][6][7]).Budding of herpesvirus nucleocapsids at the INM is driven by the nuclear egress complex (NEC) composed of two conserved herpesviral proteins designated as pUL31 and pUL34 in the alphaherpesviruses pseudorabies virus (PrV) and herpes simplex viruses (HSV-1, -2) [5][6][7]. The NEC is not only required for efficient nuclear egress, thereby generating primary enveloped virions in the PNS, but also sufficient for vesicle formation and scission from artificial lipid membranes and the INM, [8][9][10][11]. In a subsequent step, this primary envelope fuses with the ONM to release the nucleocapsids into the cytoplasm (reviewed in [12]).Budding of nucleocapsids at the INM is quite well understood at the molecular level, while the fusion process of the primary envelope with the ONM remains mostly enigmatic. In contrast to reports for HSV-1 [13], the viral fusion machinery which is active during entry of herpesviruses is not involved in nuclear egress of PrV [14]. In addition, a variety of different PrV gene deletion mutants studied so far showed no detectable effect on nuclear egress arguing against a virus-encoded fusion machinery active at the NE. Only mutants lacking the alphaherpesvirus specific protein kinase pUS3 showed an impairment of nuclear translocation. In the absence of pUS3 [15][16][17] or by impairment of its kinase function [18][19][20] primary enveloped virions accumulate in herniations of the INM. However, pUS3 is not essential for viral re...

Role of Vesicle-Associated Membrane Protein-Associated Proteins (VAP) A and VAPB in Nuclear Egress of the Alphaherpesvirus Pseudorabies Virus

“…Overexpression of a dominantnegative SUN2 resulted in accumulations of primary virions in a dilated PNS, indicating that SUN2 in the LINC complex keeps the membranes at a certain distance to allow for efficient membrane fusion [29]. In line with this, an accumulation of primary virions was found in cells deficient for the AAA + ATPases Torsin A and B with a possible impact on scission of the primary enveloped particles from the INM [30]. Torsin A is reported to be involved in LINC complex assembly and/or disassembly [31,32], again pointing to a role for the LINC complex in nuclear egress.…”

“…The sgRNA expressing plasmids were co-transfected into RK13 cells to enhance the efficiency of the knockout and to increase the chance to introduce larger deletions, specifically aiming for out-of-frame mutations to ensure absence of protein expression. Using this approach we already generated Torsin A and Torsin B single as well as double knockout cells [30].…”

The luminal AAA+ ATPase torsinA mediates distinct mechanisms of nuclear-cytoplasmic communication by adopting different functional assembly states

“…In addition, we demonstrate that the ability of torsinA to promote these two cellular processes is sensitive to the presence or absence of EGFP fused to its C-terminus. Moving forward, it will be exciting to test the effects of the E171Q and ΔNTD mutations on the following torsinA-dependent processes: ER-associated protein degredation (Esapa et al, 2007; Nery et al, 2011); nuclear egress of large ribonucleoprotein granules (Jokhi et al, 2013) and herpesvirus capsids (György et al, 2018; Maric et al, 2011; Maric et al, 2014; Turner et al, 2015; Hölper et al, 2020); nuclear membrane removal from mitotic chromatin (Luithle et al, 2020); and protein secretion (Hewett et al, 2007; Hewett et al, 2008; Torres et al, 2004). Finally, it will be important to begin to determine how torsinA oligomerizes within the peripheral ER, as torsinA is thought to be able to adopt multiple oligomeric states in this subcellular compartment (Chase et al, 2017a; Goodchild et al, 2015; Jungwirth et al, 2010).…”

A Genome-Wide CRISPR/Cas9 Screen Reveals the Requirement of Host Sphingomyelin Synthase 1 for Infection with Pseudorabies Virus Mutant gD–Pass

“…Correct cloning was verified by sequencing with primer HU6-F (ATAATTTCTTGGGTAGTTTGCAG). RK13-sgms1 KO cell lines were generated by co-transfection of all four sgRNA-containing pX330-NeoR plasmids (1.5 µg per plasmid) into cells using calcium phosphate-co-precipitation [ 57 ].…”

“…Correct cloning was verified by sequencing with primer HU6-F (ATAATTTCTTGGGTAGTTTGCAG). RK13-sgms1 KO cell lines were generated by co-transfection of all four sgRNA-containing pX330-NeoR plasmids (1.5 µg per plasmid) into cells using calcium phosphate-co-precipitation [57]. Two days after transfection in 6 well dishes, cells were transferred to 10 cm plates (Corning, Sigma-Aldrich, Darmstadt, Germany) and selected in medium containing 500 µg/mL G418 (Invitrogen, Karlsruhe, Germany).…”