From the Tunnels into the Treetops: New Lineages of Black Yeasts from Biofilm in the Stockholm Metro System and Their Relatives among Ant-Associated Fungi in the Chaetothyriales

Réblová, Martina; Hubka, Vít; Thureborn, Olle; Lundberg, Johannes; Sallstedt, Therese; Wedin, Mats; Ivarsson, Magnus

doi:10.1371/journal.pone.0163396

Cited by 33 publications

(20 citation statements)

References 114 publications

(139 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The PCR product purification followed protocol described by Réblová et al . (). Sequencing with both terminal primers and internal primer ITS4 (5′‐TCCTCCGCTTATTGATATGC) was performed at Macrogen Europe.…”

Section: Methodsmentioning

confidence: 97%

Disseminated infection due to Exophiala pisciphila in Cardinal tetra, Paracheirodon axelrodi

Řehulka

Kolařík

Hubka

2016

Journal of Fish Diseases

View full text Add to dashboard Cite

Cardinal tetra, Paracheirodon axelrodi (Schultz, 1956), kept in an ornamental tank, was found to be affected by severe invasive mycosis. Externally, the disease manifested as abdominal swelling, and internally, the anterior part of the intestine was extremely bloated with abundant dematiaceous septate hyphae and an accumulation of fluid. Histopathologically, a granulomatous inflammatory response was observed in the intestine wall, kidney and spleen. We assume that the mycotic agent was primarily deposited in the intestine and was then gradually disseminated to the other organs. DNA sequencing of ITS and LSU rDNA regions and phenotypic characterization were used for identification of the isolated fungus. The obtained data confirmed that the infection was caused by Exophiala pisciphila. The disease was subsequently reproduced in the carp fingerling using intramuscular and intraperitoneal injection of a spore suspension. The 13th day after intramuscular infection, a marked elevation of neutrophils was recorded in the peripheral blood; this involved a proliferation of band forms and segmented forms. As far as we know, this is the first report of infection due to E. pisciphila in Cardinal tetra.

show abstract

Section: Methodsmentioning

confidence: 97%

Disseminated infection due to Exophiala pisciphila in Cardinal tetra, Paracheirodon axelrodi

Řehulka

Kolařík

Hubka

2016

Journal of Fish Diseases

View full text Add to dashboard Cite

show abstract

“…ITS, BenA , CaM and RPB2 , were amplified using primer combination listed in Table 2 . PCR product purification followed the protocol described by Réblová et al. (2016) .…”

Section: Methodsmentioning

confidence: 99%

Polyphasic taxonomy of Aspergillus section Aspergillus (formerly Eurotium), and its occurrence in indoor environments and food

Chen¹,

Hubka²,

Frisvad³

et al. 2017

Studies in Mycology

119

View full text Add to dashboard Cite

Aspergillus section Aspergillus (formerly the genus Eurotium) includes xerophilic species with uniseriate conidiophores, globose to subglobose vesicles, green conidia and yellow, thin walled eurotium-like ascomata with hyaline, lenticular ascospores. In the present study, a polyphasic approach using morphological characters, extrolites, physiological characters and phylogeny was applied to investigate the taxonomy of this section. Over 500 strains from various culture collections and new isolates obtained from indoor environments and a wide range of substrates all over the world were identified using calmodulin gene sequencing. Of these, 163 isolates were subjected to molecular phylogenetic analyses using sequences of ITS rDNA, partial β-tubulin (BenA), calmodulin (CaM) and RNA polymerase II second largest subunit (RPB2) genes. Colony characteristics were documented on eight cultivation media, growth parameters at three incubation temperatures were recorded and micromorphology was examined using light microscopy as well as scanning electron microscopy to illustrate and characterize each species. Many specific extrolites were extracted and identified from cultures, including echinulins, epiheveadrides, auroglaucins and anthraquinone bisanthrons, and to be consistent in strains of nearly all species. Other extrolites are species-specific, and thus valuable for identification. Several extrolites show antioxidant effects, which may be nutritionally beneficial in food and beverages. Important mycotoxins in the strict sense, such as sterigmatocystin, aflatoxins, ochratoxins, citrinin were not detected despite previous reports on their production in this section. Adopting a polyphasic approach, 31 species are recognized, including nine new species. ITS is highly conserved in this section and does not distinguish species. All species can be differentiated using CaM or RPB2 sequences. For BenA, Aspergillus brunneus and A. niveoglaucus share identical sequences. Ascospores and conidia morphology, growth rates at different temperatures are most useful characters for phenotypic species identification.

show abstract

“…The PCR conditions were those described by Hubka et al (42). PCR product purification followed the protocol of Réblová et al (43). Automated sequencing was performed at the Macrogen Sequencing Service (Amsterdam, The Netherlands) using both terminal primers.…”

Section: Methodsmentioning

confidence: 99%

Antifungal Susceptibility of the Aspergillus viridinutans Complex: Comparison of Two In Vitro Methods

Lysková

Hubka

Svobodová

et al. 2018

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

Cryptic species of , including the species complex, are increasingly reported to be causes of invasive aspergillosis. Their identification is clinically relevant, as these species frequently have intrinsic resistance to common antifungals. We evaluated the susceptibilities of 90 environmental and clinical isolates from the species complex, identified by DNA sequencing of the calmodulin gene, to seven antifungals (voriconazole, posaconazole, itraconazole, amphotericin B, anidulafungin, micafungin, and caspofungin) using the reference European Committee on Antimicrobial Susceptibility Testing (EUCAST) method. The majority of species demonstrated elevated MICs of voriconazole (geometric mean [GM] MIC, 4.46 mg/liter) anditraconazole (GM MIC, 9.85 mg/liter) and had variable susceptibility to amphotericin B (GM MIC, 2.5 mg/liter). Overall, the MICs of posaconazole and the minimum effective concentrations of echinocandins were low. The results obtained by the EUCAST method were compared with the results obtained with Sensititre YeastOne (YO) panels. Overall, there was 67% agreement (95% confidence interval [CI], 62 to 72%) between the results obtained by the EUCAST method and those obtained with YO panels when the results were read at 48 h and 82% agreement (95% CI, 78 to 86%) when the results were read at 72 h. There was a significant difference in agreement between antifungals; agreement was high for amphotericin B, voriconazole, and posaconazole (70 to 86% at 48 h and 88 to 93% at 72 h) but was very low for itraconazole (37% at 48 h and 57% at 72 h). The agreement was also variable between species, with the maximum agreement being observed for isolates (85 and 93% at 48 and 72 h, respectively). Elevated MICs of voriconazole and itraconazole were cross-correlated, but there was no correlation between the other azoles tested.

show abstract

From the Tunnels into the Treetops: New Lineages of Black Yeasts from Biofilm in the Stockholm Metro System and Their Relatives among Ant-Associated Fungi in the Chaetothyriales

Cited by 33 publications

References 114 publications

Disseminated infection due to Exophiala pisciphila in Cardinal tetra, Paracheirodon axelrodi

Disseminated infection due to Exophiala pisciphila in Cardinal tetra, Paracheirodon axelrodi

Polyphasic taxonomy of Aspergillus section Aspergillus (formerly Eurotium), and its occurrence in indoor environments and food

Antifungal Susceptibility of the Aspergillus viridinutans Complex: Comparison of Two In Vitro Methods

Contact Info

Product

Resources

About