From Phenotypes to Genotypes and Back: Toward an Integrated Evaluation of Biodiversity in Calanoid Copepods

Abstract

Zooplankton molecular analyses allow for accurate species identification with a proper molecular signature, complementing classic phenotypic-based taxonomy (α taxonomy). For the first time in the Mediterranean Sea, cytochrome oxidase I (COI) gene sequences of calanoid copepods were associated with morphological identification, HD and SEM images, using a fully integrated approach to assess taxonomic diversity. Such method was applied to selected species, generating consensus sequences from the Gulf of Naples (Central Tyrrhenian Sea, Western Mediterranean Sea) also including reference barcodes of three target species (Nannocalanus minor, Pleuromamma gracilis and the non-indigenous species (NIS) Pseudodiaptomus marinus) that are new for the Mediterranean area. The new barcodes were selected including: dominant and rare species; species that were originally described in the study area as type locality, but lacking a molecular description; emergent NIS and potential species complex. The integration between morphological and molecular identification by tree placement, using species-specific highly conserved oligonucleotides, also provided new and high-quality references of the most common and abundant copepod genera and species in the Mediterranean Sea. Our regional reference library was then integrated and analyzed with global data reference available on BOLD database to explore the presence of potential cryptic species and biogeographic patterns and links among geographically distant populations of copepods. Overall, this study provides valuable insight into the actual copepod taxonomic diversity and contributes to building baseline knowledge to monitor coastal biodiversity in neritic areas worldwide, where copepods are of paramount ecological importance, paving the way for future metabarcoding studies.

Is integrated taxonomy useful to study diversity and ecology? An example from crustacean zooplankton at the Long‐Term ecological research site MareChiara (LTER‐MC)

“…Cyclopoida can be distinguished at species level based on detailed morphological identification (Böttger‐Schnack & Machida, 2011; Heron & Frost, 2000; Paffenhofer, 1993), but validated references are almost absent in public molecular datasets. Our sequences obtained from the GoN specimes showed that COI barcoding can accurately identify also cyclopoids at the species level (98%–100% similarity), as observed for calanoid species (Di Capua et al, 2022). COI barcoding can accurately identify Oncaea species, as discussed in Di Capua et al (2017); in addition, a new reference of O. mediterranea was obtained from a site close to its type locality (Messina; Tyrrhenian Sea).…”

“…For Cladocera, 224 COI reference sequences were downloaded from BOLD and were filtered as above. The alignment included 92 filtered data from BOLD, the E. spinifera sequences from the GoN and one sequence of a calanoid copepod species ( Calanus helgolandicus accession number JX995315.1) as an outgroup (Di Capua et al, 2022).…”

“…DNA extraction, purification, and PCR were performed as reported by Di Capua et al (2022). Folmer et al (1994) primers pairs (LCO1490:5′‐GGTCAACAAATCATAAAGATATTGG‐3 HCO2198: 5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′) were used in PCR to amplify the COI gene of crustaceans, considered a universal marker for marine zooplankton (Bucklin et al, 2011, 2021; Bucklin, Hopcroft, et al, 2010).…”

“…More than 200 zooplanktonic taxa have been regularly identified through diagnostic morphological characters at the Long‐Term Ecological Research station MareChiara (LTER‐MC) in the Gulf of Naples (GoN; Central Tyrrhenian Sea, Western Mediterranean Sea) from 1984 to 2015 (Mazzocchi et al, 2023). In a previous paper, phenotype‐based approaches were combined with molecular ones to identify key calanoid copepod species collected at LTER‐MC, revealing the occurrence of cryptic species and the biogeographic connections among different populations (Di Capua et al, 2022). The same methodological framework is here extended to other relevant components of the LTER‐MC zooplankton assemblage, focusing on key target crustacean taxa (Copepoda, Cladocera, Malacostraca) with a pivotal role in the pelagic ecosystems, not only at the investigated station but also in neritic areas worldwide (Castellani & Edwards, 2017).…”

“…More than 200 zooplanktonic taxa have been regularly identified through diagnostic morphological characters at the Long-Term Ecological Research station MareChiara (LTER-MC) in the Gulf of Naples (GoN; Central Tyrrhenian Sea, Western Mediterranean Sea) from 1984 to 2015 (Mazzocchi et al, 2023). In a previous paper, phenotype-based approaches were combined with molecular ones to identify key calanoid copepod species collected at LTER-MC, revealing the occurrence of cryptic species and the biogeographic connections among different populations (Di Capua et al, 2022).…”