fos-associated cellular p39 is related to nuclear transcription factor AP-1

Sassone–Corsi, Paolo; Lamph, William W.; Kamps, Mark P.; Verma, Inder M.

doi:10.1016/0092-8674(88)90077-3

Cited by 485 publications

(244 citation statements)

References 33 publications

Supporting

Mentioning

231

Contrasting

Unclassified

Order By: Relevance

“…A sequence of separate events leads to an accumulation of genetic damage and each of these events consists of either activation or inactivation of growth regulatory genes and proteins (Moolenaar et al, 1986). The FOS/JUN complex binds specifically to a DNA sequence referred to as the AP-1 binding site and thus affects the transcriptional expression of cellular genes (Sassone-Corsi et al, 1988). MYC is also involved in transcriptional regulation (Spandidos et al, 1990).…”

mentioning

confidence: 99%

Prognostic value of ERBB-1, VEGF, cyclin A, FOS, JUN and MYC in patients with squamous cell lung carcinomas

Volm

Rittgen²,

Drings³

1998

Br J Cancer

155

View full text Add to dashboard Cite

Summary Patients with previously untreated squamous cell lung carcinomas were evaluated to see if combining the expression of molecular and cellular factors with the most important clinical prognostic factors could improve the diagnostic ability to predict prognosis. For this reason, immunohistochemistry was used to examine the squamous cell lung carcinomas from 121 patients for their expression of ERBB-1, vascular endothelial growth factor (VEGF), cyclin A, FOS, JUN and MYC. Median survival was shorter for patients with ERBB-1-, VEGF-, cyclin A-, FOS-, or JUN-positive tumours. For those patients with positive lymph node involvement, the survival times were also shorter in the VEGF-positive, cyclin A-positive and FOS-positive groups. Multivariate analysis independently demonstrated a significant prognostic value for lymph node involvement, VEGF and FOS.

show abstract

mentioning

confidence: 99%

Prognostic value of ERBB-1, VEGF, cyclin A, FOS, JUN and MYC in patients with squamous cell lung carcinomas

Volm

Rittgen²,

Drings³

1998

Br J Cancer

155

View full text Add to dashboard Cite

show abstract

“…Heterodimerization appears necessary for high-affinity binding to DNA, and in the case of c-Fos/c-Jun (Chiu et al 1988;Sassone-Corsi et al 1988) and c-Myc/Max (Amati et al 1992;Kretzner et al 1992), dimerization has been correlated with higher transcriptional activity. Through analysis of the transcriptional activation mediated by E2F-1, we have now demonstrated that E2F-1 is able to dimerize with DP-1 in vivo C-33A cells were transfected in duplicate with variable amounts of pCMVE2F-1 ( x ) or variable amounts of pCMVE2F-1 in combination with 50 ng of pCMVDP-1 (O), together with 2 gog of reporter construct containing four E2F DNA-binding sites in front of the cat gene (E2F4CAT), 2 wg of pRSVluciferase, and carrier DNA to a total of 22 wg/9-cm dish.…”

Section: Discussionmentioning

confidence: 99%

“…Several transcription factors have been shown to bind DNA as heterodimers {for review, see Jones 1990), and heterodimerization has been correlated with higher transcriptional activity (see Chiu et al 1988;Sassone-Corsi et al 1988;Amati et al 1992;Kretzner et al 1992). To examine the functional significance of E2F-1 and DP-1 heterodimerization, C-33A cells were transfected with increasing amounts of expression plasmids containing either E2F-1 (Fig.…”

Section: E2f-1 and Dp-1 Cooperate In Trans-activationmentioning

confidence: 99%

Heterodimerization of the transcription factors E2F-1 and DP-1 leads to cooperative trans-activation.

Helin¹,

Wu²,

Fattaey³

et al. 1993

Genes Dev.

462

484

View full text Add to dashboard Cite

The E2F transcription factor has been implicated in the regulation of genes whose products are involved in cell proliferation. Two proteins have recently been identified with E2F-like properties. One of these proteins, E2F-1, has been shown to mediate E2F-dependent trans-activation and to bind the hypophosphorylated form of the retinoblastoma protein {pRB). The other protein, mudne DP-1, was purified from an E2F DNA-affinity column, and it was subsequently shown to bind the consensus E2F DNA-binding site. To study a possible interaction between E2F-1 and DP-1, we have now isolated a cDNA for the human homolog of DP-1. Human DP-1 and E2F-1 associate both in vivo and in vitro, and this interaction leads to enhanced binding to E2F DNA-binding sites. The association of E2F-1 and DP-1 leads to cooperative activation of an E2F-responsive promoter. Finally, we demonstrate that E2F-1 and DP-1 association is required for stable interaction with pRB in vivo and that trans-activation by E2F-1/DP-1 heterodimers is inhibited by pRB. We suggest that "E2F" is the activity that is formed when an E2F-l-related protein and a DP-l-related protein dimerize.

show abstract

“…The 1-kb insert of pCdx2-1Luc was obtained by PCR on murine genomic DNA using the primers Cdx2P a/b: d CCAGCCATCCACTAATTACT / dGCTGTCTGGGGA-CAAACGTT (James et al, 1994). Plasmid pHO6T1 encodes the human mutated (Val 12) Ha-ras oncoprotein (Spandidos and Wilkie, 1984), pcDNA-PKCa encodes human pKCa (Finkenzeller et al, 1992), pSV-c-jun and pBK28-c-fos code for the murine c-Jun and human c-Fos proteins (Sassone-Corsi et al, 1988;Van Beveren et al, 1983); pCR3 was from Invitrogen.…”

Section: Plasmidsmentioning

confidence: 99%

Downregulation of the colon tumour-suppressor homeobox gene Cdx-2 by oncogenic ras

et al. 1999

View full text Add to dashboard Cite

Constitutive activation of the ras proto-oncogene is a frequent and early event in colon cancers, but the downstream nuclear targets are not fully understood. The Cdx-1 and Cdx-2 homeobox genes play crucial roles in intestinal cell proliferation and di erentiation. In addition, Cdx-2 is a colonic tumour-suppressor gene, whereas Cdx-1 has oncogenic potential. Here, we show that constitutive activation of ras alters Cdx-1 and Cdx-2 expression in human colonic Caco-2 and HT-29 cells that harbour a normal ras proto-oncogene. Oncogenic ras downregulates Cdx-2 through activation of the PKC pathway and a decline in activity of the Cdx-2 promoter AP-1 site. This decline results from a PKC-dependent decrease in the relative expression of c-Jun, an activator of Cdx-2 transcription, compared to c-Fos, an inhibitor of Cdx-2. Unlike Cdx-2, Cdx-1 is upregulated by oncogenic ras and this e ect is mediated by activation of the MEK1 pathway. These results indicate that oncogenic ras activation has opposite e ects on Cdx-1 and Cdx-2 expression through distinct signalling pathways and they provide the ®rst evidence for a functional link between ras activation and the downregulation of the Cdx-2 tumour-suppressor gene in colon cancer cells.

show abstract

fos-associated cellular p39 is related to nuclear transcription factor AP-1

Cited by 485 publications

References 33 publications

Prognostic value of ERBB-1, VEGF, cyclin A, FOS, JUN and MYC in patients with squamous cell lung carcinomas

Prognostic value of ERBB-1, VEGF, cyclin A, FOS, JUN and MYC in patients with squamous cell lung carcinomas

Heterodimerization of the transcription factors E2F-1 and DP-1 leads to cooperative trans-activation.

Downregulation of the colon tumour-suppressor homeobox gene Cdx-2 by oncogenic ras

Contact Info

Product

Resources

About