Formation of STAT1-STAT2 Heterodimers and Their Role in the Activation of IRF-1 Gene Transcription by Interferon-α

Li, Xiaoxia; Leung, Stewart; Qureshi, Sajjad A.; Darnell, James; Stark, George R.

doi:10.1074/jbc.271.10.5790

Cited by 183 publications

(143 citation statements)

References 31 publications

Supporting

Mentioning

137

Contrasting

Order By: Relevance

“…Most STAT molecules in cell extracts behave as single 91-kDa molecules (17), but it is still possible that a subset is bound to a specific site, perhaps even the receptor itself. Binding of Stat2 to the IFN-␣ receptor has been described previously (10). Finally, however, since it is clear that [ 32 P]pY-labeled Stat1 appears in the nucleus before serine 727 phosphorylation occurs, it is not possible to rule out the occurrence of serine phosphorylation in the nucleus for those molecules that enter the nucleus without prior serine phosphorylation.…”

Section: Discussionmentioning

confidence: 95%

Stat1 Serine Phosphorylation Occurs Independently of Tyrosine Phosphorylation and Requires an Activated Jak2 Kinase

Zhu

Wen

et al. 1997

Molecular and Cellular Biology

145

109

View full text Add to dashboard Cite

Gamma interferon (IFN-␥) induces both tyrosine and serine phosphorylation of Stat1. Stat1 serine phosphorylation is required for maximal transcriptional activity of Stat1. In this report, we present evidence that Stat1 tyrosine phosphorylation is not a prerequisite for Stat1 serine phosphorylation, although an active Jak2 kinase is required for both phosphorylation events. Stat1 serine phosphorylation occurs with a more delayed time course than tyrosine phosphorylation. The occurrence of serine phosphorylation without tyrosine phosphorylation suggests that serine phosphorylation takes place in the cytoplasm. Experiments performed with cells expressing either dominant-negative or constitutively active Ras protein indicated that the Ras-mitogenactivated protein kinase pathway is probably not involved in IFN-␥-induced Stat1 serine phosphorylation. Finally, a kinase capable of correct Stat1 serine phosphorylation was detected in partially purified cytoplasmic extracts from both IFN-␥-treated and untreated cells.Polypeptide signalling that changes gene expression often involves the STAT proteins (16). These latent cytoplasmic transcription factors become activated by phosphorylation of tyrosine residues, catalyzed either by receptor-associated Janus (Jak) kinases or by receptor tyrosine kinases. The STAT molecules then dimerize by reciprocal phosphotyrosine-SH2 interactions and enter the cell nucleus to effect transcriptional changes. It has been amply demonstrated that transcriptional activation is further amplified when the serine residues of STAT proteins are phosphorylated (22). A single serine in Stat3 and Stat1, residue 727 in both cases, appears to be the major, if not the only, serine kinase target site (21). In addition to these studies, a number of other findings suggestive of serine phosphorylation of STATs that are also tyrosine phosphorylated have been described. For example, Stat3 and Stat5 show a ligand-dependent, slower migration that is also time dependent and is inhibited by the serine kinase inhibitor H7 (2,3,24).The signalling pathway(s) involved in serine phosphorylation of the STATs is not known at present, although we do show here that Jak2 is required for STAT serine phosphorylation in response to gamma interferon (IFN-␥). In this study, we explored the time course and cellular locus of serine and tyrosine phosphorylation and the potential interdependence of the two. In addition, we examined the nature of the serine phosphorylation pathways, demonstrating the lack of evidence for participation of several prominent serine kinases. However, we did detect a kinase capable of catalyzing phosphorylation of Stat1, predominantly on residue 727. MATERIALS AND METHODSCell culture. U3A cells (13,14), ␥2A cells (12), and their derived cell lines were grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% cosmic serum (HyClone Laboratories Inc.). NIH 3T3 cells and cells stably transfected with either dominant-negative Ras (dnRas) or constitutively active Ras (CARas) were grown in DMEM supple...

show abstract

Section: Discussionmentioning

confidence: 95%

Stat1 Serine Phosphorylation Occurs Independently of Tyrosine Phosphorylation and Requires an Activated Jak2 Kinase

Zhu

Wen

et al. 1997

Molecular and Cellular Biology

145

109

View full text Add to dashboard Cite

show abstract

“…Notably in the absence of IRF9, expression of STAT2 Y631F restored the antiproliferative effects of IFN␣; however, IRF9 remains essential in the promotion of apoptosis. This result comes as no surprise because there are reports that STAT1/STAT2 heterodimers in the absence of IRF9 bind to a distinct DNA element, termed palindromic IFN response element (pIRE), which is similar to the consensus GAS element that drives expression of specific ISGs, such as IRF1 (Li et al, 1996;Ghislain et al, 2001).…”

Section: Discussionmentioning

confidence: 96%

A Mutation in the SH2 Domain of STAT2 Prolongs Tyrosine Phosphorylation of STAT1 and Promotes Type I IFN-induced Apoptosis

Scarzello

Romero-Weaver

Maher

et al. 2007

MBoC

View full text Add to dashboard Cite

Type I interferons (IFN-␣/␤) induce apoptosis in certain tumor cell lines but not others. Here we describe a mutation in STAT2 that confers an apoptotic effect in tumor cells in response to type I IFNs. This mutation was introduced in a conserved motif, PYTK, located in the STAT SH2 domain, which is shared by STAT1, STAT2, and STAT3. To test whether the tyrosine in this motif might be phosphorylated and affect signaling, Y631 of STAT2 was mutated to phenylalanine (Y631F). Although it was determined that Y631 was not phosphorylated, the Y631F mutation conferred sustained signaling and induction of IFN-stimulated genes. This prolonged IFN response was associated with sustained tyrosine phosphorylation of STAT1 and STAT2 and their mutual association as heterodimers, which resulted from resistance to dephosphorylation by the nuclear tyrosine phosphatase TcPTP. Finally, cells bearing the Y631F mutation in STAT2 underwent apoptosis after IFN-␣ stimulation compared with wild-type STAT2. Therefore, this mutation reveals that a prolonged response to IFN-␣ could account for one difference between tumor cell lines that undergo IFN-␣-induced apoptosis compared with those that display an antiproliferative response but do not die.

show abstract

“…The following oligonucleotides were used in EMSAs (listed 5Ј to 3Ј: complement sequence are not shown): sis-inducible element of the c-Fos promoter region (m67SIE): GTCGACATTTCCCGTAAATC (41); IRF1-GAS: GTGATTTCCCCGAAATGACG (17). Briefly, complementary oligonucleotides were annealed, labeled with [␥-…”

Section: Methodsmentioning

confidence: 99%

“…Both responses are STAT1-dependent and involve binding of STAT1 homodimers to GAS elements in the 5Ј-flanking regions of these genes (4,16,17). TAP proteins contribute to the assembly and peptide loading of nascent class I MHC molecules (18,19), while IRF1 mediates the delayed transcription of class I MHC molecules as well as sustained transcription of TAP proteins (15,16,20).…”

Section: Vascular Endothelial Cells (Ec)mentioning

confidence: 99%

See 1 more Smart Citation

Activation of Signal Transducer and Activator of Transcription 1 (STAT1) Is Not Sufficient for the Induction of STAT1-dependent Genes in Endothelial Cells

Mahboubi

Pober²

2002

Journal of Biological Chemistry

View full text Add to dashboard Cite

We compared human endothelial cell (EC) responses to interferon-␥ (IFN␥) and oncostatin M (OnM), Vascular endothelial cells (EC)1 are the principal cellular targets of many pro-and anti-inflammatory cytokines. They are unusually sensitive to activation by interferon-␥ (IFN␥), showing IFN␥-dependent expression of class I and class II major histocompatibility complex (MHC) molecules under basal conditions, when most other cell types are unresponsive (1-3). A previous study from our laboratory suggested that this sensitivity may be attributed to the fact that EC are relatively deficient in expression of Src homology-containing phosphatase-1 (SHP-1) which normally dampens signaling by IFN␥ (4). The predominant signaling pathway activated by IFN␥ involves Janus kinases (JAKs), namely JAK1 and JAK2, and signal transducer and activator of transcription-1 (STAT1) (5-8). Binding of IFN␥ to IFN␥ receptor-1 (IFNGR1) in the presence of IFN␥ receptor-2 (IFNGR2) results in receptor clustering followed by rapid phosphorylation of the intracellular region of the IFNGR1 at Tyr residue 440 by receptor-associated JAKs (7). Cytoplasmic STAT1 proteins then bind to this phosphorylated Tyr residue in IFNGR1 and subsequently become phosphorylated themselves at Tyr residue 701 by receptor-associated JAKs. The tyrosine-phosphorylated STAT1 proteins dissociate from the receptor and form a homodimer which translocates to the nucleus and binds to specific ␥-activated sequence (GAS) elements (TTCNNNGAA consensus sequence) in the enhancers of IFN␥-inducible genes, stimulating their transcription (9, 10). The ability of STAT1 to activate gene transcription may additionally depend on phosphorylation of Ser residue 727, possibly through the actions of a mitogenactivated protein kinase (MAPK) family member (11-13).Many cell types, including EC, respond to IFN␥ by rapidly increasing the expression of TAP1 and IRF1 (14,15). Both responses are STAT1-dependent and involve binding of STAT1 homodimers to GAS elements in the 5Ј-flanking regions of these genes (4,16,17). TAP proteins contribute to the assembly and peptide loading of nascent class I MHC molecules (18,19), while IRF1 mediates the delayed transcription of class I MHC molecules as well as sustained transcription of TAP proteins (15,16,20). The coordinated up-regulation of these proteins by IFN␥ enhances the capacity of these cells to present foreign peptides bound to class I MHC molecules to cytolytic CD8 ϩ T cells (21). In this way, IFN␥ contributes to immune-mediated

show abstract

Formation of STAT1-STAT2 Heterodimers and Their Role in the Activation of IRF-1 Gene Transcription by Interferon-α

Cited by 183 publications

References 31 publications

Stat1 Serine Phosphorylation Occurs Independently of Tyrosine Phosphorylation and Requires an Activated Jak2 Kinase

Stat1 Serine Phosphorylation Occurs Independently of Tyrosine Phosphorylation and Requires an Activated Jak2 Kinase

A Mutation in the SH2 Domain of STAT2 Prolongs Tyrosine Phosphorylation of STAT1 and Promotes Type I IFN-induced Apoptosis

Activation of Signal Transducer and Activator of Transcription 1 (STAT1) Is Not Sufficient for the Induction of STAT1-dependent Genes in Endothelial Cells

Contact Info

Product

Resources

About