Follicular Stimulating Hormone Accelerates Atherogenesis by Increasing Endothelial VCAM-1 Expression

Abstract

Rationale: Postmenopausal atherosclerosis (AS) has for decades been attributed to estrogen deficiency. Although the follicular stimulating hormone (FSH) levels rise sharply in parallel, the direct effect of FSH on AS has never been investigated. In this study, we explored the possible role of FSH in the development of AS.Methods: This was a prospective cohort study of 48 healthy premenopausal and 15 postmenopausal women. ApoE knockout mice were used as atherosclerosis model and human umbilical vascular endothelial cells (HUVECs) were cultured as cell model. Serum hormones and vascular cell adhesion molecule-1 (VCAM-1) levels were measured. Real-time PCR, histology for atherosclerotic lesions, immunofluorescence, luciferase assay, transfection experiments, flow chamber adhesion assay and western blot were performed.Results: In ApoE knockout mice, administration of FSH increased the atherosclerotic lesions and serum VCAM-1 concentration. Importantly, in blood samples of postmenopausal women, we detected significantly higher levels of FSH and VCAM-1 compared with those from premenopausal women, and there was a positive correlation between these two molecules. In cultured HUVECs, FSH receptor (FSHR) mRNA and protein expression were detected and FSH enhanced VCAM-1 expression. This effect was mediated by the activation of nuclear factor κB (NF-κB), which was sequentially enhanced by the activation of PI3K/Akt/mTOR cascade. FSH first enhanced GαS activity resulting in elevated cAMP level and PKA activity, which relayed the signals from FSHR to the PI3K/Akt/mTOR cascade. Furthermore, FSHR was detected in endothelial caveolae fraction and interacted with caveolin-1 and GαS. The disruption of caveolae or the silencing of caveolin-1 blocked FSH effects on signaling activation and VCAM-1 expression, suggesting the existence of a functional signaling module in membrane caveolae. Finally, FSH increased human monocyte adhesion to HUVECs which was reversed by the VCAM-1 neutralizing antibody.Conclusion: FSHR was located in the membrane caveolae of HUVECs and FSH promoted VCAM-1 expression via FSHR/GαS /cAMP/PKA and PI3K/Akt/mTOR/NF-κB pathway. This may contribute to the deleterious role of FSH in the development of AS in postmenopausal women.

Follicle‐stimulating hormone promotes renal tubulointerstitial fibrosis in aging women via the AKT/GSK‐3β/β‐catenin pathway

“…Postmenopausal status is characterized by high levels of FSH and LH, as well as low levels of E2, making it difficult to explore the precise role of FSH in renal function in the OVX mouse model. To diminish the potential effect of these two parameters, we used GnRHa‐treated ovariectomized mice administered with recombinant FSH in accordance with several studies (Li, Chen, et al, ; Song et al, ). Given that kidney injury is a relatively chronic process, we increased the dose of FSH from 0.15 IU to 0.3 IU and lengthened intervention time to 6 weeks, which was different from Liu's study on fat accumulation.…”

Extragonadal Effects of Follicle-Stimulating Hormone on Osteoporosis and Cardiovascular Disease in Women during Menopausal Transition

“…Interestingly, FSHR was specifically localized in caveolae of endothelial cells. Caveolin-1, the main protein component of caveolae, directly interacted with FSHR and mediated its downstream signaling actions [36].…”

“…"Epidemiological and animal studies have revealed that FSH contributes to the decline in bone health in women undergoing menopausal transition. Emerging data has shown that FSH treatment enhances atherosclerotic plaque formation in ovariectomized AopE -/mice [36]. However, our understanding of the molecular mechanisms through which FSH increases the risk of osteoporosis and cardiovascular disease is far from complete (see outstanding questions)."…”

Posttranscriptional regulation of MMP‐9 by HuR contributes to IL‐1β‐induced pterygium fibroblast migration and invasion

“…Total RNA was isolated from tissues and PTFs with Trizol or Purelink RNA mini kit for reverse transcription and PCR amplification as described previously (Cui et al, ; Li et al, ). PCR primers were as folllows: (a) for MMP‐9, 5′‐GCGTCTTCCCCTTCACTTTC‐3′ (Forward) and 5′‐ATAGGGTACATGAGCGCCTC‐3′ (Reverse); (b) for HuR, 5′‐CCAACTTGTACATCAGCGGG‐3′ (Forward) and 5′‐GGCTGCAAACTTCACTGTGA‐3′ (Reverse); (c) for glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), 5′‐GTCAGTGGTGGACCTGACCT‐3′ (Forward) and 5′‐TGCTGTAGCCAAATTCGTTG‐3′ (Reverse).…”

“…bio-rad.com/en-us/product/quantity-one-1-d-analysis-software; RRID:SCR_014280.) 2.12 | RT-PCR and quantitative real-time PCR analysis Total RNA was isolated from tissues and PTFs with Trizol or Purelink RNA mini kit for reverse transcription and PCR amplification as described previously (Cui et al, 2016;Li et al, 2017). PCR primers were as folllows:…”