Foamy virus vectors for suicide gene therapy

Abstract

To improve the delivery of so-called suicide genes into immunoblot and polymerase chain reaction (PCR). The tumors, recombinant retroviruses were constructed by functionality of the suicide genes was determined by a inserting the herpes virus type 1 (HSV-1) thymidine kinase metabolic assay on virus vector infected cells and (tk), the E. coli cytosine deaminase (cd) and polynucleotreatment with the respective prodrugs. In terms of vector side phosphorylase (pnp), or the jellyfish gene for the stability and effectiveness of specific cell killing a virus green fluorescent protein (gfp) into a foamy virus (FV)-transducing the pnp gene (FOV-7/pnp) was superior to derived replication-competent vector (pFOV-7). Expression those using the other two suicide genes. FOV-7/pnp is a and stability of the inserted foreign gene was analyzed by candidate virus for suicide gene delivery into solid tumors.Keywords: foamy virus vectors; suicide gene therapy; thymidine kinase; cytosine deaminase; polynucleoside phosphataseVirus vector-mediated intratumoral delivery of enzymes neuropathy. 12,13 In these animals the expression of an accessory viral gene product of unknown function that is which convert prodrugs to toxic active drugs has gained increasing interest among experimental cancer theranot required for viral replication, 14 the Bet protein, has been identified as the most likely candidate for inducing pists.1,2 Common retrovirus vector-mediated delivery is often used in experimental protocols, and human trials the neural damage in these animals. 12,15 On the basis of the so-called human FV (HFV), which most likely rephave been initiated using a murine leukemia virus (MLV)-derived packaging cell line and a MLV-derived resents a chimpanzee virus variant, 4-6 replicating viral vectors have been constructed in which most of the bet vector expressing the HSV-1 TK.3 After injection of vector producing packaging cells into tumors, the virus vector open reading frame (ORF) has been deleted. 16 We investigated the possibility of replacing the bet ORF by different is able to perform one round of reverse transcription and integration. Since MLV-derived vectors only integrate suicide genes and tested their stability and functionality in the context of the replicating virus in vitro (criterion into proliferating cells, tumor cells are much more susceptible to infection by the virus vector than normal (4) as described above). As shown in Figure 1, control and suicide genes were tissue. 3 We decided to test the possibility of introducing suicinserted into the replicating vector pFOV-7. 16 Compared with the wild-type HFV, pFOV-7 has a large deletion in ide genes into a replicating retrovirus vector to improve the strategy of virus-mediated destruction of tumor cells. the U3 region of the long terminal repeat (LTR). This deletion has been recently shown to improve HFV repliWe reasoned that such a virus vector should be (1) nonpathogenic; (2) of primate origin to ensure efficient infeccation in fibroblastoid cells. 17 In addition, most of the b...

Experimental therapy of allogeneic solid tumors induced in athymic mice with suicide gene-transducing replication-competent foamy virus vectors

“…pFOV-7/tk and pFOV-7/pnp have been characterized previously. 18 pFOV-7/ntr was also shown to specifically kill virus-infected cells in vitro following addition of the respective prodrug (data not shown). The stability of the inserted suicide gene during 10 cellfree passages could be demonstrated for the FOV-7/pnp and the FOV-7/ntr viruses by immunoblot and PCR, whereas the deletion of the tk insert in the FOV-7/tk virus was detected after three cell-free passages of the virus (Rethwilm 18 and data not shown).…”

“…19,20 The parental infectious molecular FV clone pHSRV2, the replication-competent FV vector pFOV-7, and the suicide gene-transducing recombinant vectors pFOV-7/tk, expressing herpes simplex virus thymidine kinase, and pFOV-7/pnp, expressing Escherichia coli purine nucleoside phosphorylase, have been described previously. 18 The ntr gene was PCR amplified from JM101 bacteria using the primers #420 (5 0 GGGCCCGGGAATGGATATCATTTCTGTCGCC TTA) and #421 (5 0 GGGCCCGGGTTACACTTCGGTT AAGGTGATGTT). The amplimer was digested with SmaI and inserted into a SmaI cut pBluescript vector.…”

“…Following DNA sequencing to verify the correct ntr gene sequence the 0.66 kb SmaI fragment was inserted into SmaI cut pFOV-7 in-frame to the deleted bet coding sequence as described previously for other pFOV-7 constructs. 18 This resulted in the plasmid pFOV-7/ntr (Fig 1).…”

“…Cells infected by these vectors in vitro showed good expression of functional active recombinant proteins. 17,18 Experimental therapy of allogeneic solid tumors M Heinkelein et al Prodrugs Gancyclovir (Cymeven from Roche) served as prodrug for herpes simplex virus tk. The pnp prodrug 9-D-2-deoxyerythropentofuranosyl-6-methylpurine (MePdR) 23 was synthesized via coupling of triacetyl-D-ribofuranose with silylated N-methylpurine in the presence of trimethylsilyltrifluoromethanesulfate.…”

“…17 In a follow-up study we used the replicationcompetent pFOV-7 vector type for the generation of various suicide gene-transducing viruses. 18 Here we constructed an additional suicide gene-expressing vector (pFOV-7/ntr) and analyzed three virus-suicide gene combinations for their ability to suppress tumor growth in a human glioma xenograft mouse model.…”