Fluorogen‐activating proteins as biosensors of cell‐surface proteins in living cells

Abstract

This study explores the general utility of a new class of biosensor that allows one to selectively visualize molecules of a chosen membrane protein that are at the cell surface. These biosensors make use of recently described bipartite fluoromodules comprised of a fluorogen-activating protein (FAP) and a small molecule (fluorogen) whose fluorescence increases dramatically when noncovalently bound by the FAP (SzentGyorgyi et al., Nat Biotechnol 2008;26:235-240 CELLS that express single-pass recombinant membrane proteins, each presenting a FAP on the exterior face of the plasma membrane and a standard fluorescent protein (EGFP or mRFP) on the interior face, were generated and examined by fluorescence microscopy. In each case, fluorescent signal was observed exclusively at the cell surface when the FAP domain was imaged using membrane-impermeant fluorogen but was observed in additional intracellular locations when the fluorescent protein domain was imaged. Cells that expressed external N-terminal FAP-fusions to three wellstudied human membrane proteins-the b2 adrenergic receptor (b 2 AR), the insulinregulated glucose transporter (GLUT4), and the cystic fibrosis transmembrane conductance regulator (CFTR)-were also generated and examined; these too showed fluorescent signal exclusively at the cell surface after exposure to membrane-impermeant fluorogen. Further, when endocytosis of tagged b 2 AR was stimulated by agonist treatment in the presence of fluorogen, fluorescent signal was seen to transit from the surface to the cell interior. FAP tagging thus provides a means for selectively visualizing plasma membrane proteins and for monitoring the trafficking of these proteins to and from the cell surface.Plasma membrane proteins play roles in thousands of cellular processes and are the targets of more than half of all therapeutic drugs. Many of these proteins exhibit regulated translocation between the cell surface and the cell interior. For example, most G-protein coupled receptors (GPCRs) and receptor tyrosine kinases are internalized by endocytosis after exposure to agonists (1,2), and numerous ion and metabolite transporters traffic to the membrane in response to particular physiological stimuli (3).Many methods are available to selectively label particular plasma membrane proteins in living cells with fluorescent molecules so as to study membrane protein trafficking. These include immunofluorescence with specific antibodies or antibodies to epitope tags, labeling of tetracysteine (TC) tagged fusion proteins with FlAsH or ReAsH reagents, covalent attachment of fluorophores using SNAP-tag or Halo Tag

Pharmacological Rescue of the Mutant Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Detected by Use of a Novel Fluorescence Platform

“…FAP fusions to the N-terminus of CFTR with an additional membrane-spanning segment were generated using the pBabeSacLac2 plasmid, described previously (24). Briefly, CFTRs (both WT and F508del) were amplified by polymerase chain reaction (PCR) from pcDNA3 using primers that provided SfiI restriction sites (forward: GGCCC AGCCGGCCATGCAGAGGTCGCCTCT GGAA; reverse: GCCCCTGCGGCCCTA AAGCCTTGTATCTTGCAC).…”

“…First, we modified the N-terminus to include the FAP and an additional transmembrane segment, derived from the PDGF receptor; this is called FAP-CFTR (24). Second, we inserted the FAP tag into the fourth extracellular loop of CFTR, to generate CFTR EL4-FAP (Figure 1).…”

Regulated recycling of mutant CFTR partially restored by pharmacological treatment

“…In the present study, we have applied a recently developed fluorescence detection technology called fluorogen activating proteins (FAPs) to selectively and instantaneously label CFTR at the PM in living cells in order to follow the trafficking itineraries of CFTR WT or F508del endocytosed from the cell surface (Holleran et al, 2010;Holleran et al, 2012;Szent-Gyorgyi et al, 2008). The FAP system offers several advantages over traditional biochemical or immunofluorescence techniques for studying CFTR trafficking in living cells.…”

Breaking the color barrier – a multi-selective antibody reporter offers innovative strategies of fluorescence detection

“…S2) fused at the N-terminal to adrenoreceptor β2 (ADRB2) on mammalian cells was performed using the pDisplaySacLac2 plasmid (Holleran et al, 2010). HL1.0.1-TO1 and HL1-TO1 gene inserts (Szent-Gyorgyi et al, 2008) were PCR amplified to include a 5′ SfiI restriction site sequence 5′-GGCCCAG-CCGGCC-3′ and 3′ SfiI restriction site sequence 5′-GGCCGCAGGGGCC-3′, and each insert cloned into a SfiI enzyme-digested pDisplaySacLac2.…”

“…Furthermore, FAP reporters have demonstrated a rapid advancement as tools for labeling targets at the surface of cells (Fig. S1), showing absence of intracellular background/noise and high cell-surface signal brightness that is comparable to (or greater) than conventional fluorescent proteins (Holleran et al, 2010;Saunders et al, 2012;Szent-Gyorgyi et al, 2008.…”