FLT3 ligand gene expression and protein production in human colorectal cancer cell lines and clinical tumor specimens

Abstract

Dendritic cells (DC) are professional antigen presenting cells (APC) whose proliferation and functional differentiation can be induced by hematopoietic growth factors including GM‐CSF and FLT3 ligand (FL). Colorectal cancers are known to be infiltrated by dendritic cells (DC) and neoplastic cells have been shown to produce GM‐CSF. In this work we investigated FLT3 ligand (FL) gene expression and protein production in human colorectal cancer cell lines and clinical tumor specimens. Using reverse transcription polymerase chain reaction (RT‐PCR), 6 out of 6 established tumor lines were found to express to variable extents FL gene. In 1 of them, SW480, FL immunoreactivity could be observed by taking advantage of specific antibodies. In contrast, soluble FL could not be detected in any culture supernatant. FLT3 receptor (FR) gene was not expressed and exogenous addition to the cultures of recombinant FL (rFL) did not affect the proliferation of the tumor lines. FL gene expression was investigated using a densitometry‐assisted, semiquantitative RT‐PCR in clinical tumor specimens. Specific FL gene transcripts were amplified from 12 of 12 surgical samples. In these cases, FL gene expression of significantly lower intensity was also detected in healthy mucosa sampled in the vicinity (2 cm) or at a distance (10 cm) from neoplastic outgrowth. Immunohistochemical studies identified FL‐positive cancer cells in 5 of 5 cases tested. No positivity was detected in healthy mucosa epithelia at a distance from the tumor or in stromal cells. FL content in preoperative sera from colorectal cancer patients (n = 13) did not exceed the levels detected in healthy donors (≤ 100 pg/ml). Int. J. Cancer 86:238–243, 2000. © 2000 Wiley‐Liss, Inc.

Differences in metabolic biomarkers in the blood and gene expression profiles of peripheral blood mononuclear cells among normal weight, mildly obese and moderately obese subjects

“…CD19 is overexpressed in various cancers, whereas LPAR5 protects against tumour formation ( 38 , 39 ) . In this case, the up-regulation of oncogenes AXIN2, FLT3LG , NFKBIA , BIRC3 , DDIT3 , and PDE4B and down-regulation of suggested tumour-suppressor genes CACNA2D3 , HSPA1A and APAF1 occurred continuously in both Obese A and Obese B groups ( 40 – 48 ) . Moreover, more cancer-related genes were expressed in PBMC from the Obese B group than in PBMC from the Obese A group, indicating that after cancer initiation in the early stage of obesity, this ongoing process drives cancer towards more invasive stages.…”

Functional features of cancer stem cells in melanoma cell lines

“…The expression of the genes encoding the melanoma-associated antigens (MAAs) gp100, tyrosinase, and Melan-A/MART-1 and the cancer/testis antigens (CTA) MAGE-A3 and NY-ESO was assessed by conventional PCR, its extent was semiquantitatively evaluated by densitometry as previously described by Spagnoli [31,32]. Primers and probes for the housekeeping gene ß-actin (hACTB) as well as for NANOG, OCT4, SOX2, and MAGE-3 and MGP were provided by Assays-on-Demand, Gene Expression Products (Applied Biosystems, Foster City, CA, USA).…”

Interaction of interleukin-7 and interleukin-3 with the CXCL12-induced proliferation of B-cell progenitor acute lymphoblastic leukemia

“…27 IL-7, 28 Flt-3L forward 29 and Flt-3L reverse, 30 and GAPDH forward (acgcatttggtcgtattggg) and reverse (tgattttggagggatctcgc).…”