Flagellin From Pseudomonas aeruginosa Modulates SARS-CoV-2 Infectivity in Cystic Fibrosis Airway Epithelial Cells by Increasing TMPRSS2 Expression

Abstract

In the coronavirus disease 2019 (COVID-19) health crisis, one major challenge is to identify the susceptibility factors of severe acute respiratory syndrome-coronavirus-2 (SARS-CoV-2) in order to adapt the recommendations for populations, as well as to reduce the risk of COVID-19 development in the most vulnerable people, especially patients with chronic respiratory diseases such as cystic fibrosis (CF). Airway epithelial cells (AECs) play a critical role in the modulation of both immune responses and COVID-19 severity. SARS-CoV-2 infects the airway through the receptor angiotensin-converting enzyme 2, and a host protease, transmembrane serine protease 2 (TMPRSS2), plays a major role in SARS-CoV-2 infectivity. Here, we show that Pseudomonas aeruginosa increases TMPRSS2 expression, notably in primary AECs with deficiency of the ion channel CF transmembrane conductance regulator (CFTR). Further, we show that the main component of P. aeruginosa flagella, the protein flagellin, increases TMPRSS2 expression in primary AECs and Calu-3 cells, through activation of Toll-like receptor-5 and p38 MAPK. This increase is particularly seen in Calu-3 cells deficient for CFTR and is associated with an intracellular increased level of SARS-CoV-2 infection, however, with no effect on the amount of virus particles released. Considering the urgency of the COVID-19 health crisis, this result may be of clinical significance for CF patients, who are frequently infected with and colonized by P. aeruginosa during the course of CF and might develop COVID-19.

Highly restricted SARS-CoV-2 receptor expression and resistance to infection by primary human monocytes and monocyte-derived macrophages

“…Total RNA was extracted from cells using RNeasy Plus Kit (Qiagen) and 100 ng total RNA was reverse transcribed to cDNA using random hexamers and high‐capacity reverse transcription kit (Thermo Fisher). ACE2 was amplified using primer‐probe set Hs01085333_m1 and TMPRSS2 was amplified using primer‐probe set Hs00237175_m1 as described 11 , 12 , 13 (both from Applied Biosystems) using Taqman universal mastermix (Thermo Fisher). qPCR for housekeeping GUSB gene was performed using Powerup SYBR green mastermix (Thermo Fisher) using primers GUSB_F: CGCCCTGCCTATCTGTATTC and GUSB_R: TCCCCACAGGGAGTGTGTAG.…”

Interactions Between Severe Acute Respiratory Syndrome Coronavirus 2 Replication and Major Respiratory Viruses in Human Nasal Epithelium

“…This model, consisting of human airway primary cells grown at the air/liquid interface, is a truly relevant model for studying respiratory viruses and within-host interactions. For example, our group has used this model several times to characterize and compare different respiratory viruses such as influenza viruses, RSV, hMPV [29,34] or [28], but also to experimentally simulate scenarios of interactions between pathogens, including bacterial/fungal superinfections [35][36][37].…”

Receptors and Cofactors That Contribute to SARS-CoV-2 Entry: Can Skin Be an Alternative Route of Entry?

“…TMPRSS2 was also found to be upregulated on primary airway epithelial cells and Calu-3 upon TLR5 stimulation by P. aeruginosa flagella. TMPRSS2 induction by flagellin depends on p38 and NF-kB and increases infectivity of SARS-CoV-2 [ 55 ].…”