Five missense mutations at the adenosine deaminase locus (ADA) detected by altered restriction fragments and their frequency in ADA – patients with severe combined immunodeficiency (ADA – SCID)

Abstract

Severe combined immunodeficiency (SCID) is a heterogeneous syndrome, due to X-linked and autosomal recessive defects. A significant proportion of the autosomal recessive forms of SCID are due to mutations at the adenosine deaminase (ADA) locus. Nine different mutations at the ADA locus, including 7 missense point mutations, have been reported in children with ADA-SCID. We could detect 5 of the 7 missense mutations associated with ADA-SCID by alterations in restriction fragments utilizing standard restriction digestion of genomic DNA and hybridization of radiolabelled ADA genomic probes to Southern transfers. We additionally developed more rapid nonradioactive methods employing digestion of genomic DNA amplified by PCR that also detected all 5 mutations. Using these methods, we have examined a sample of 45 ADA-SCID chromosomes and report that these 5 missense mutations account for one third of the ADA--chromosomes studied, with 2 mutations being relatively common.

Two newly identified mutations (Thr233Ile and Leu152Met) in partially adenosine deaminase-deficient (ADA - ) individuals that result in differing biochemical and metabolic phenotypes

“…Sequence analysis of double-stranded DNA was performed using a Sequenase kit (US Biochemicals, Cleveland, Ohio) and ADA-specific primers (Bonthron et al 1985). For GM03043, DNA was extracted and amplified by the polymerase chain reaction (PCR) to contain exons 1, 2, 3, 4-5, 7-9 and 10-11 and the sequence determined by cycle sequencing, as previously described, using an fMole kit (Promega, Madison, Wis.) (Hirschhorn 1992;Hirschhorn et al 1992Hirschhorn et al , 1994a.…”

Two new mutations at the adenosine deaminase (ADA) locus (Q254X and del nt1050-54) unusual for not being missense mutations

“…Patients studied, their source and amplification of exons 10-11 and 7-9 by polymerase chain reaction (PCR) from genomic DNA were as described (Hirschhorn et al, 1992a). Exon 1, contained in a 360-nt fragment, was amplified using 10% DMSO, a 5' sense primer (H063, S'CCGAGCCGGCAGAGACCCAC) in the untranslated region of exon 1 and a 3' antisense primer (H019, 5' ACTTGACAGACAGC-GAAACTGAGACCCAGA) in IVS 1, denaturing at 94°C for 1 min, annealing at 65°C for 1.3 min, and extending at 72°C for 3.5 min.…”

T-cell lines from 2 patients with adenosine deaminase (ADA) deficiency showed the restoration of ADA activity resulted from the reversion of an inherited mutation

“…Primers and polymerase chain reaction (PCR) conditions used were described previously. 2,12,13 Each PCR-amplified fragment was purified and then directly sequenced as described. 14 To verify the mutations detected, the fragments including the mutation were digested with restriction enzymes BfaI and BglI (New England Biolabs, Beverly, MA) and PvuII (Promega, Madison, WI).…”