Fish primary embryonic pluripotent cells assemble into retinal tissue mirroring in vivo early eye development

Abstract

Organoids derived from pluripotent stem cells promise the solution to current challenges in basic and biomedical research. Mammalian organoids are however limited by long developmental time, variable success, and lack of direct comparison to an in vivo reference. To overcome these limitations and address species-specific cellular organization, we derived organoids from rapidly developing teleosts. We demonstrate how primary embryonic pluripotent cells from medaka and zebrafish efficiently assemble into anterior neural structures, particularly retina. Within 4 days, blastula-stage cell aggregates reproducibly execute key steps of eye development: retinal specification, morphogenesis, and differentiation. The number of aggregated cells and genetic factors crucially impacted upon the concomitant morphological changes that were intriguingly reflecting the in vivo situation. High efficiency and rapid development of fish-derived organoids in combination with advanced genome editing techniques immediately allow addressing aspects of development and disease, and systematic probing of impact of the physical environment on morphogenesis and differentiation.

Boosting targeted genome editing using the hei-tag

“…To address whether the high targeting efficiency of heiCas9 was conveyed by the high molar excess employed or was possibly restricted to the oca2 locus, we turned to a multiplexing regime at 10-fold reduced concentrations of the Cas9 variants employed. We targeted four different genomic loci with four different sgRNAs: exonic targeting of oca2 ( OlOca2 T2 ), targeting of the start codon of the retina-specific transcription factor 2 ( rx2 ; Stemmer et al, 2015 ), and the crystallin alpha a ( cryaa ; Stemmer et al, 2015 ) as well as intronic targeting of rx3 ( Zilova et al, 2021 ). Medaka one-cell stage embryos were co-injected with a mix of 12.5 ng/µl per sgRNA, the 10-fold reduced (15 ng/µl) zCas9 or heiCas9 mRNA and 20 ng/µl mCherry mRNA as injection tracer.…”

“…The following target sites were used [PAM in brackets]: OlOca2 T1 ( GAAACCCAGGTGGCCATTGC [AGG]), OlOca2 T2 ( TTGCAGGAATCATTCTGTGT [GGG]), OlOca2 T3 ( GATCCAAGTGGAGCAGACTG [AGG]), OlOca2 T4 ( CACAATCCAGGCCTTCCTGC [AGG]) DrOca2 T1 ( GTACAGCGACTGGTTAGTCA [TGG]), DrOca2 T2 ( TAAGCACGTAGACTCCTGCC [AGG]), Rx2 ( GCATTTGTCAATGGATACCC [TGG]), Cryaa ( GGGAGAAGTGCTTGACATCC [AGG]), Rx3 ( AGCAGAGCGCGCAAAGAACC [AGG]). OlOca2 T1 , OlOca2 T2, and DrOca2 T1 were the same as in Hammouda et al, 2019 , OlOca2 T3 was the same as in Lischik et al, 2019 (OCA2_4), OlRx2 and OlCryaa are from Stemmer et al, 2015 , and OlRx3 is the same used in Zilova et al, 2021 . Cloning of sgRNA templates was performed as described ( Stemmer et al, 2015 ).…”

The inceptionist’s guide to base editing – de novo PAM generation to reach initially inaccessible target-sites

“…Next, we generated splice-site mutations as an efficient alternative to establish knock-outs (Garcia-Tunon et al, 2019). We used inception to target the splice-acceptor-site of coding exon 2 of the retinal homeobox transcription factor 3 gene ( rx3 ) known to cause eyeless phenotypes (Loosli et al, 2001, Zilova et al, 2021) (Fig. 2D).…”

“…Following guide RNAs were used in this work (in 5’-3’ direction, PAM in brackets): oca2-newPAM sgRNA, TTGCAGGAATCATTCTGTGT[GGG] (Hammouda et al, 2019); oca2-inception sgRNA, GGAAACCCAGGTGGCCATTG[CAG]; kcnh6a-newPAM sgRNA, TGAAGACAGCCCGACTGCTC[AGG] (Cornean et al, 2022); kcnh6a-inception-original crRNA, TCTCATTGGATTACTGAAGg[CAG]; kcnh6a-inception-adjusted crRNA TCTCATTGGATTACTGAAGg[CAG]; rx3-newPAM sgRNA, AGCAGAGCGCGCAAAGAACC[AGG] (Zilova et al, 2021); rx3-inception-adjusted crRNA, CCGGCGCTGTGAGGAGAGCg[GAG].…”

Teleost Fish and Organoids: Alternative Windows Into the Development of Healthy and Diseased Brains

“…The latter are becoming attractive in vitro alternatives in conjunction to the in vivo models to recapitulate species (i.e. human)-specific traits of early neurogenesis, differentiation, connectivity and even cytoarchitecture at small scale ( Krefft et al, 2021 ; Zilova et al, 2021 ; Figure 1 and Table 1 ). Direct comparisons of COs development derived from different primates, mammals or other vertebrates are also becoming supportive tools for our understanding of the mechanisms underlying neocortex expansion ( Li et al, 2017b ; Kanton et al, 2019 ; Pollen et al, 2019 ).…”