First report of Seville root-knot nematode, Meloidogyne hispanica (Nematoda: Meloidogynidae) in the USA and North America

Abstract

A high number of second stage juveniles of the root-knot nematode were recovered from soil samples collected from a corn field, located in Pickens County, South Carolina, USA in 2019. Extracted nematodes were examined morphologically and molecularly for species identification which indicated that the specimens of root knot juveniles were Meloidogyne hispanica. The morphological examination and morphometric details from second-stage juveniles were consistent with the original description and redescriptions of this species. The ITS rRNA, D2-D3 expansion segments of 28S rRNA, intergenic COII -16S region, nad5 and COI gene sequences were obtained from the South Carolina population of M. hispanica . Phylogenetic analysis of the intergenic COII -16S region of mtDNA gene sequence alignment using statistical parsimony showed that the South Carolina population clustered with Meloidogyne hispanica from Portugal and Australia. To our best knowledge, this finding represents the first report of Meloidogyne hispanica in the USA and North America.

Molecular and morphological characterization of Tylenchus zeae n. sp. (Nematoda: Tylenchida) from Corn (Zea mays) in South Carolina

“…For individuals where the long fragment 18S was unsuccessful, primer 18S1.2 (5’– GGCGATCAGATACCGCCCTAG TT– 3’) and 18Sr2b (5’– TACAAAGGGCAGGGACGTAAT– 3’) were used. The D2-D3 expansion segments of 28S rRNA gene were amplified with primers D2A (5’–ACAAGTACCGTGAGGGAAAGTT – 3’) and D3B (5’– TCGGAAGGAACCAGCTACTA – 3’) ( De Ley et al, 2005 ) as described previously ( Skantar et al, 2021 ). The mitochondrial COI gene was amplified with primers JB3 (5’– TTTTTTGGGCATCCTGAGGTTTAT–3’) and JB5 (5’– AGCACCTAAACTTAA AACATAATGAAAATG– 3’) according to Derycke et al (2010) .…”

First report of barley root-knot nematode, Meloidogyne naasi from turfgrass in Idaho, with multigene molecular characterization

“…Molecular markers continue to be a useful tool for distinguishing Meloidogyne species, particularly ribosomal large subunit (LSU) D2-D3 segments of the 28S rDNA (Skantar et al, 2021;Trinh et al, 2022;Zeng et al, 2022) and the mitochondrial DNA interval that spans the region between genes encoding cytochrome oxidase subunit II (COII) and 16S rRNA (Powers and Harris, 1993;Subbotin, 2021;Subbotin and Burbridge, 2021). IGS-2 has been sequenced from several RKN species, but not from M. naasi.…”

“…IGS-2 has been sequenced from several RKN species, but not from M. naasi. Mitochondrial cytochrome oxidase 1 (COI) has gained popularity as a molecular barcode for many nematodes and is useful for differentiating some RKN species (M. fallax, M. chitwoodi, M. minor, M. naasi, and M. hapla) (Alvarez-Ortega, 2019;Powers et al, 2018;Skantar et al, 2021), as is the nuclear protein coding gene heat shock protein 90 (Hsp90) (Nischwitz et al, 2013).…”

Tomato rootstocks for the control of Meloidogyne spp.

“…When the second-stage juvenile (J2) infects the plant and feeds on a cell, it produces an abnormal cell growth followed by multiple acytokinetic mitosis that lead to the formation of a large multinucleate giant cell . The most damaging species of Meloidogyne are M. arenaria (Neal) Chitwood, arietinum) or durum wheat (Triticum durum), cereals like barley (Hordeum vulgare) or sorghum (Sorghum vulgare) and crucifer crops such as cabbage (Brassica oleracea) or radish (Raphanus sativus) among others (Greco et al, 1992;Hernández et al, 2005); M. hispanica was first described infecting peach rootstocks (Prunus persica silvestris) although it can also infect tomato, pepper and watermelon (Hirschmann, 1986); finally, M. baetica was described in southern Spain infecting wild olive trees (Olea europaea spp. sylvestris) (Castillo et al, 2003).…”