First Report of <i>Bipolaris yamadae</i> Leaf Spot Disease on Guinea Grass (<i>Panicum maximum</i>) in Florida

Adhikari, Ashish; Wang, Xuechun; Lane, Brett; Harmon, Philip F.; Goss, Erica M.

doi:10.1094/pdis-07-20-1486-pdn

Cited by 5 publications

(1 citation statement)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Genomic DNA was extracted from the isolated single strain using a TIANamp DNA Kit (Beijing Tiangen Biochemical Co., Ltd., China) according to the manufacturer's instruction. The V3–V4 region of bacterial 16S rRNA genes and the ITS region of fungal ribosomal RNA (rRNA) genes were the polymerase chain reaction (PCR) amplified using two universal primer sets, 27 forward (F) (5′‐AGAGTTTGATCCTGGCTCAG‐3′)/1492 reverse (R) (5′‐GGTTACCTTGTTACGACTT‐3′) (Adhikari et al., 2020 ; Zhang et al., 2019 ) and internal transcribed spacer 1 (ITS1) (5′‐TCCGTAGGTGAACCT GCGG‐3′)/internal transcribed spacer 4 (ITS4) (5′‐TCCTCCGCTTATTGATATGC‐3′) (Kim, Koh, et al, 2017 ). The PCR amplification products were detected using agarose gel electrophoresis and sequenced by the Chengdu Qingke Biotechnology Company.…”

Section: Methodsmentioning

confidence: 99%

Insight into the protein degradation during the broad bean fermentation process

Lin

Zhou

Zhao

et al. 2022

Food Science & Nutrition

View full text Add to dashboard Cite

Broad bean fermentation is of vital importance in PixianDouban (PXDB) production, as well as a key process for microorganisms to degrade protein, which lays the foundation for the formation of PXDB flavor. In this study, two fungi and bacteria were screened, and their morphology, molecular biology, growth, and enzyme production characteristics were analyzed, and then they were applied to the broad bean fermentation simulation system. The protein, peptide, amino acid, amino nitrogen, and sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) in the system were evaluated. The results showed that the four microorganisms were Aspergillus oryzae , Aspergillus jensenii , Staphylococcus gallinarum , and Enterobacter hormaeche . Aspergillus oryzae had the highest protease activity at pH 7.0, while the other three strains had better enzyme activity stability under neutral acidic conditions. And the total protein (F1 and F2 were 18.32 g/100 g, 19.15 g/100 g, respectively), peptides (11.79 ± 0.04 mg/g and 12.06 ± 0.04 mg/g), and amino acids (55.12 ± 2.78 mg/g and 54.11 ± 1.97 mg/g) of the fungus experimental groups (F) were higher than the bacterial experimental groups (B). In addition, the enzyme system produced by fungi exhibited a stronger ability for albumin (20 kDa) and glutenin (<30 kDa) deterioration in neutral conditions, while the bacterial enzyme system was more efficient in degrading albumin (<30 kDa) and glutenin (20–30 kDa) in acidic conditions, as indicated by SDS‐PAGE. These findings showed that both bacteria and fungi played an important role in the degradation of protein in different fermentation stages of broad bean fermentation. Practical applications There is a lack of comprehensive understanding of the protein composition and protein degradation mechanism of broad beans in the fermentation stage of PXDB. This research work explored the differences in the degradation of PXDB fermented protein by different microorganisms, and provided a theoretical basis for optimizing the production of PXDB and improving the quality of PXDB.

show abstract

Section: Methodsmentioning

confidence: 99%

Insight into the protein degradation during the broad bean fermentation process

Lin

Zhou

Zhao

et al. 2022

Food Science & Nutrition

View full text Add to dashboard Cite

show abstract

First report of Bipolaris yamadae causing leaf blight on giant reed (Arundo donax L.) in Mexico and its pathogenicity on sorghum and maize

et al. 2022

View full text Add to dashboard Cite

First Report of Bipolaris sorokiniana Leaf Spot Disease on Watermelon (Citrullus lanatus) in Florida

et al. 2023

View full text Add to dashboard Cite

Watermelon is an important crop in Florida, representing $88.2 million in cash receipts in 2015 (USDA/NASS 2017). In April and May 2021, the UF/IFAS Plant Diagnostic Center in Gainesville, Florida received eight diseased watermelon leaf samples from Alachua, Gilcrest, Levy, and Suwannee counties in Florida. Lesions were round to oblong, light gray to tan with reddish brown margins and white to light gray center, and some were coalescing resulting in about 15% disease severity. Symptomatic leaf tissue (0.5 cm2) was surface sterilized in 0.6% sodium hypochlorite for one minute, rinsed with sterile tap water, plated onto water agar media plates, and incubated at 27°C under 12-h light/dark cycle for 7 days. Characteristic Bipolaris conidia with gray to black brownish cottony mycelial growth were consistently found growing from plated lesions. The pathogen was isolated from two of the eight samples using a 0.5 mm diameter sterile metal needle to transfer a single conidium onto DifcoTM Potato Dextrose Agar (PDA) plates. Three isolates were designated G21-562 from Levy and G21-599a and G21-599b from Alachua County. All three isolates produced curved or straight, cylindrical, obclavate, distoseptate brownish gray conidia with 3 to 8 septa, mostly tapering towards ends with dark brownish to black hilum, that ranged from averaged 62um x 25um (n=30, SD=8 for length and 3 for width). Conidiophores were brownish, septate, smooth, and straight, single or in small groups, simple or branched, and swollen at the upper tip. Internal transcribed spacer region (ITS) and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene sequences were amplified using primers ITS1/ITS4 and GPD-1/GPD-2 (Berbee et al. 1999). Reference sequences (Adhikari et al. 2020 and Manamgoda et al. 2014) were aligned using MUSCLE and trimmed to consistent length. Using concatenated sequence alignments of both loci, a maximum likelihood phylogenetic tree was constructed based on K2+G substitution model selected by BIC using Mega X (Kumar et al. 2018) with 1,000 bootstrap. The ITS and GPDG sequences of G21_599b, G21_599a and G21_562 (GenBank accessions OK614094 to 96, OP297398 to 400) showed 100% identity across 888 nucleotides across both loci to B. sorokiniana isolates CBS_110.14 and CBS_ 120.24 and were distinct from other reference isolates. To fulfill Koch’s postulates, all three isolates were grown on PDA at 27°C and 12-h light/dark cycle. After a week, conidia were harvested in sterile water, and the conidial suspensions were adjusted to 105 conidia/ml using a hemocytometer. Each conidial suspension and Tween 20 water control was sprayed onto three seedlings of ‘Sugar Baby’ watermelon until runoff, and inoculated seedlings were sealed in a plastic bag for 24 hrs. The experiment was done in a greenhouse (20- 25°C) and repeated once. After a week of incubation, the same leaf lesion symptoms described above were observed on seedlings inoculated with conidia, whereas seedlings sprayed with the control were asymptomatic. Isolations from symptomatic tissue produced gray to black mycelia with conidia that were the same as described from field samples. To our knowledge, this is the first report of leaf spot on watermelon caused by B. sorokiniana. B. sorokiniana is a common pathogen of grasses and agronomic crops (Farr and Rossman 2020). The extent to which this emerging disease of Florida watermelon may negatively impact production is unknown and should be the subject of future observation and research.

show abstract

First Report of Bipolaris yamadae Leaf Spot Disease on Guinea Grass (Panicum maximum) in Florida

Cited by 5 publications

References 8 publications

Insight into the protein degradation during the broad bean fermentation process

Insight into the protein degradation during the broad bean fermentation process

First report of Bipolaris yamadae causing leaf blight on giant reed (Arundo donax L.) in Mexico and its pathogenicity on sorghum and maize

First Report of Bipolaris sorokiniana Leaf Spot Disease on Watermelon (Citrullus lanatus) in Florida

Contact Info

Product

Resources

About