First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease

Abstract

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAG- ATGTCCACTAATGATA 3′) were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity. References: (1) N. W. Frazier and L. L. Stubbs. Plant Dis. Rep. 53:524, 1969. (2) I. E. Tzanetakis et al. (Abstr.) Phytopathology 92:S82, 2002.

Virus Decline of Strawberry in California and the Role of Insect Vectors and Associated Viruses

“…Virus decline of strawberry, also referred to as pallidosisrelated decline of strawberry or pallidosis disease, is caused by a complex of viruses transmitted by whiteflies, aphids, thrips, pollen, nematodes, seeds, and some other unknown sources (Converse et al 1987;Martin and Tzanetakis 2006;Tzanetakis et al 2003a;Tzanetakis et al 2003b;Tzanetakis et al 2013;Wintermantel 2004;). Virus decline occurs only when one of the whitefly-transmitted viruses is present in the plant along with one of the viruses transmitted by other sources (Fig.…”

Epidemiology of criniviruses: an emerging problem in world agriculture

“…Typical symptoms include interveinal chlorosis as leaves mature ( Figure 1 ), reduced growth and fruit size, and early senescence in cucurbits (Wisler et al, 1998a). BPYV was first reported in a rosaceous host, strawberry in 2002 and is one of the criniviruses that can induce strawberry pallidosis disease in Fragaria virginiana Duchesne clones UC-10 and UC-11 (Tzanetakis et al, 2003). In California, where the vector has become naturalized, BPYV is now quite common in strawberry (Martin and Tzanetakis, 2013).…”

Bemisia: Bionomics and Management of a Global Pest

“…Although Beet pseudo yellows virus (BPYV) had been known to exist in coastal regions of California since the 1960s, it was only identified as a problem in pumpkin and strawberry in the early 2000s during a period of tremendous population growth by its vector, Trialeurodes vaporariorum (Tzanetakis et al 2003;Wintermantel 2004b). Although Beet pseudo yellows virus (BPYV) had been known to exist in coastal regions of California since the 1960s, it was only identified as a problem in pumpkin and strawberry in the early 2000s during a period of tremendous population growth by its vector, Trialeurodes vaporariorum (Tzanetakis et al 2003;Wintermantel 2004b).…”