First molecular survey of animal trypanosomes in Paraguayan horses

Electrocardiographic Changes Associated with Trypanosomiasis in Horses

“…PCR tests were performed using two pairs of primers for analysis Details on the primers used in the ITS1CF/BR PCR Trypanozoon are F:5'-CCGGAAGTTCACCGATATTG-3' R:5'-TGCTGCGTTCTTCAACGAA-3' 480 bp [14]. RoTat 1.2 PCR T. evansi F:5'-GCGGGGTGTTTAAAGCAATA-3' R:5'-ATTAGTGCTGCGTGTGTTCG-3' 205 bp according to [15] and TVW primers T. vivax-specific, TVW 1: TGAGTGCTCCATGTGCCAC and TVW2: CCACCAGAACACCAACCTGA 150 bp [16]. According to the method of amplification of PCR described by Suganuma et al [16].…”

“…RoTat 1.2 PCR T. evansi F:5'-GCGGGGTGTTTAAAGCAATA-3' R:5'-ATTAGTGCTGCGTGTGTTCG-3' 205 bp according to [15] and TVW primers T. vivax-specific, TVW 1: TGAGTGCTCCATGTGCCAC and TVW2: CCACCAGAACACCAACCTGA 150 bp [16]. According to the method of amplification of PCR described by Suganuma et al [16]. The products were analyzed by electrophoresis in a 1.5% agarose gel and UV illumination after staining the DNA with ethidium bromide.…”

Molecular detection and internal transcribed spacer-1 sequence diversity of <i>Trypanosoma evansi</i> in goats from Cavite, Philippines

“…In addition, phylogenetic analysis revealed that the ITS-1 sequences were highly identical to the sequences from the parasite originating from a wide range of hosts including camel, water buffalo and horses as seen in Figure 1. This further suggests that a potential active transmission between domestic animals is a common occurrence contributing to the genetic diversity of the parasite [1,4,8,17,18]. Further, complete ITS-1 sequences from 6 selected samples namely: S2, S6, S7, S9, S10 and S14 were analyzed from the total of 14 positive samples.…”

“…The primers used for the first PCR (TBR1 and 2) were as follows; forward (5′-CGA ATG AAT ATT AAA CAA TGC GCA G-3′) and reverse (5′-AGA ACC ATT TAT TAG CTT TGT TGC-3′), respectively [ 10 ]. The optimized PCR conditions used for the amplification of this gene was done as previously described [ 18 ]. Positive samples from the initial PCR were then subjected to the second PCR for amplifying ITS-1 sequence.…”

“… . This further suggests that a potential active transmission between domestic animals is a common occurrence contributing to the genetic diversity of the parasite [ 1 , 4 , 8 , 17 , 18 ]. Further, complete ITS-1 sequences from 6 selected samples namely: S2, S6, S7, S9, S10 and S14 were analyzed from the total of 14 positive samples.…”