Fibrillin-2b regulates endocardial morphogenesis in zebrafish

Abstract

scotch tape (sco) is a zebrafish cardiac mutant initially proposed to exhibit a reduced amount of cardiac jelly, the extracellular matrix between the myocardial and endocardial layers. We analyzed sco(te382) mutant hearts in detail using both selective plane illumination microscopy (SPIM) and transmission electron microscopy (TEM), and observed a fascinating endocardial defect. Time-lapse SPIM imaging of wild-type and mutant embryos revealed significant and dynamic gaps between endocardial cells during development. Although these gaps close in wild-type animals, they fail to close in the mutants, ultimately leading to a near complete absence of endocardial cells in the atrial chamber by the heart looping stage. TEM analyses confirm the presence of gaps between endocardial cells in sco mutants, allowing the apparent leakage of cardiac jelly into the lumen. High-resolution mapping places the sco(te382) mutation within the fbn2b locus, which encodes the extracellular matrix protein Fibrillin 2b (OMIM ID: 121050). Complementation and further phenotypic analyses confirm that sco is allelic to puff daddy(gw1) (pfd(gw1)), a null mutant in fbn2b, and that sco(te382) is a hypomorphic allele of fbn2b. fbn2b belongs to a family of genes responsible for the assembly of microfibrils throughout development, and is essential for microfibril structural integrity. In sco(te382) mutants, Fbn2b is disabled by a missense mutation in a highly conserved cbEGF domain, which likely interferes with protein folding. Integrating data obtained from microscopy and molecular biology, we posit that this mutation impacts the rigidity of Fbn2b, imparting a structural defect that weakens endocardial adhesion thereby resulting in perforated endocardium.

Genetic Interaction between pku300 and fbn2b Controls Endocardial Cell Proliferation and Valve Development in Zebrafish

“…S3G). Consistent with the previous report (Mellman et al, 2012), we found that fbn2bMO morphants lost most of the Tg(kdrl:EGFP) atrial endocardium but had no defect in the Fig. 3.…”

“…nonsense mutation in sco te382 mutants, phenocopying sco te382 mutant phenotypes by antisense pku300 morpholino knockdown, rescuing sco te382 mutant phenotypes by overexpressing the wildtype pku300 gene in the endothelium and endocardium, and determining pku300 mRNA expression in the endocardium. As reported recently (Mellman et al, 2012), we also found the G3935T missense mutation of fbn2b in our sco te382 mutant. Mutational analyses of fbn2b and pku300 allowed us to further classify two groups of mutants in sco te382 , where group I mutants were heterozygous for both genes and group II mutants were homozygous for both genes (supplementary material Table S2; Fig.…”

“…We identified the four genes calreticulin (calr), LAG1 longevity assurance homolog 4 (trh1), 182 (ZDB-GENE-070705-222 or ENSDART00000147116) and calcium homeostasis endoplasmic reticulum protein (cherp) from this genetic interval. A recent report showed that fbn2b is mutated in the sco te382 locus (Mellman et al, 2012), however fbn2b was located outside of this genetic interval on our genetic mapping panel ( Fig. 2A).…”

“…Note that the sco te382 locus, which contains calr, trh1, pku300 and cherp genes, was determined between markers 6 and 9 by genotyping 1632 informative meiosis using SLP and SNP methods. A G3935T missense mutation of fbn2b is reported to be responsible for the sco te382 locus (Mellman et al, 2012), but fbn2b is located outside of the genetic interval in our mapping cross DNA panels. fbn2b is about 570 kb away from pku300.…”

“…Two antisense morpholinos were synthesized to target the zebrafish pku300 ATG site (pku300MO1): AAATCATACCTCAGCGAAGCTCACA; the first splicing donor site (pku300MO2): GTGTTGTAGCACCTGTAATTTTCA; fbn2b start site targeted morpholino (fbn2bMO): GCGACTCCTGAAGCGCCGGTAAATG (Mellman et al, 2012); and a control morpholino (CtrMO): GCAGC-GGGCACTGCTGGTGGAAGT (Gene Tools, LLC). The full length of wild type and mutant pku300 cDNAs were cloned into T7TS vector and linearized, and capped mRNA was synthesized using Ambion mMESSAGE mMACHINE mRNA transcription synthesis kits.…”