FGF signaling establishes the anterior border of the <i>Ciona</i> neural tube

Wagner, Eileen; Levine, Michael

doi:10.1242/dev.078485

Cited by 87 publications

(135 citation statements)

References 74 publications

Supporting

Mentioning

120

Contrasting

Order By: Relevance

“…Bertrand et al, 2003;Davidson et al, 2006;Wagner and Levine, 2012). Our study demonstrates that FGF signaling also controls the timing of cell divisions and midline convergence of medial row I cells.…”

Section: Fgf/mapk Signaling and Cellular Morphogenesismentioning

confidence: 58%

“…The Mnx −5 kb regulatory sequence was amplified from genomic DNA using the primers F-TATGGCGCGCCTCCTGATGTGACGGATTTATGACTG, R-TATG-CGGCCGCTAGCATCATTTTAAATCTTAAATATCAAAGGTTC and cloned into a H2B:Cherry-containing expression vector using NotI and AscI restriction sites. dnFGFR and Elk:VP64 were digested from Dmrt4> dnFGFR (Wagner and Levine, 2012) and Zicl>ElkLVP64 (Gainous et al, 2015) using NotI and BlpI and cloned downstream of the FoxB and Mnx enhancers. A clone of the Ciona MEK1/2 gene (citb42j03) was modified to produce the amino acid changes S116D and S220E using the primers TATGATCTTGTCCCTACAAACTCGTTGGCCATATCGTCGATCAGT-TGCCCGCTCAC and GTGAGCGGGCAACTGATCGACGATATGGC-CAACGAGTTTGTAGGGACAAGATCATA and the Stratagene quickchange site-directed mutagenesis procedure.…”

Section: Molecular Cloningmentioning

confidence: 99%

See 1 more Smart Citation

Nodal and FGF coordinate ascidian neural tube morphogenesis

Navarrete

Levine

2016

Development

Self Cite

View full text Add to dashboard Cite

Formation of the vertebrate neural tube represents one of the premier examples of morphogenesis in animal development. Here, we investigate this process in the simple chordate Ciona intestinalis. Previous studies have implicated Nodal and FGF signals in the specification of lateral and ventral neural progenitors. We show that these signals also control the detailed cellular behaviors underlying morphogenesis of the neural tube. Live-imaging experiments show that FGF controls the intercalary movements of ventral neural progenitors, whereas Nodal is essential for the characteristic stacking behavior of lateral cells. Ectopic activation of FGF signaling is sufficient to induce intercalary behaviors in cells that have not received Nodal. In the absence of FGF and Nodal, neural progenitors exhibit a default behavior of sequential cell divisions, and fail to undergo the intercalary and stacking behaviors essential for normal morphogenesis. Thus, cell specification events occurring prior to completion of gastrulation coordinate the morphogenetic movements underlying the organization of the neural tube.

show abstract

Section: Fgf/mapk Signaling and Cellular Morphogenesismentioning

confidence: 58%

Section: Molecular Cloningmentioning

confidence: 99%

Nodal and FGF coordinate ascidian neural tube morphogenesis

Navarrete

Levine

2016

Development

Self Cite

View full text Add to dashboard Cite

show abstract

“…Previous work identified the FGF-MAPK signaling pathway as an important regulator of both specification and subsequent morphogenesis of the palps (Hudson et al, 2003;Wagner and Levine, 2012). Specifically, we showed that perturbation of FGF-MAPK signaling led to ectopic FoxC expression, but larvae that developed under these conditions failed to develop palps.…”

Section: Fgf-mapk Signaling Is Required For Proper Islet Patterningmentioning

confidence: 62%

“…6B, compare with control larva in Fig. 6A) (Wagner and Levine, 2012). Combining the DMRT>DN FGFR perturbation with FoxC>Islet, however, led to a rescue of palp development.…”

Section: Islet Rescues Palp Development Upon Inhibition Of Fgf Signalingmentioning

confidence: 79%

Islet is a key determinant of ascidian palp morphogenesis

et al. 2014

Self Cite

View full text Add to dashboard Cite

The anterior-most ectoderm of ascidian larvae contains the adhesive papillae, or palps, which play an important role in triggering the metamorphosis of swimming tadpoles. In Ciona intestinalis, the palps consist of three conical protrusions within a field of thickened epithelium that form late in embryogenesis, as tailbuds mature into larvae. The palp protrusions express the LIM-homeodomain transcription factor Islet. Protrusion occurs through differential cell elongation, probably mediated by Islet, as we find that ectopic expression of Islet is sufficient to promote cell lengthening. FGF signaling is required for both Islet expression and palp morphogenesis. Importantly, we show that Islet expression can rescue the palpdeficient phenotype that results from inhibition of FGF signaling. We conclude that Islet is a key regulatory factor governing morphogenesis of the palps. It is conceivable that Islet is also essential for the cellular morphogenesis of placode-derived sensory neurons in vertebrates.

show abstract

“…In Ciona intestinalis, several cases of differential ERK activation between sister cells have been described during marginal zone and neural lineage patterning. This differential ERK activation between sister cell pairs dictates their differential fate specification Stolfi et al, 2011;Wagner and Levine, 2012;Yasuo and Hudson, 2007) (reviewed by Lemaire, 2009). Importantly, in several of these cases, differential ERK activation is achieved via ephrin/Eph-dependent attenuation of FGF/ERK signalling (Picco et al, 2007;Shi and Levine, 2008;Stolfi et al, 2011).…”

Section: Introductionmentioning

confidence: 99%

p120RasGAP mediates ephrin/Eph-dependent attenuation of FGF/ERK signals during cell fate specification in ascidian embryos

et al. 2013

Self Cite

View full text Add to dashboard Cite

SUMMARYERK1/2 MAP kinase exhibits a highly dynamic activation pattern in developing embryos, which largely depends on fibroblast growth factor (FGF) signals. In ascidian embryos, FGF-dependent activation of ERK1/2 occurs differentially between sister cells during marginal zone and neural lineage patterning. Selective attenuation of FGF signals by localised ephrin/Eph signals accounts for this differential ERK activation, which controls the binary fate choice of each sibling cell pair. Here, we show that p120 Ras GTPase-activating protein (p120RasGAP) is a crucial mediator of these ephrin/Eph signals. First, inhibition of p120RasGAP has a similar effect to inhibition of ephrin/Eph function during marginal zone and neural patterning. Second, p120RasGAP acts epistatically to ephrin/Eph signals. Third, p120RasGAP physically associates with Eph3 in an ephrin-dependent manner. This study provides the first in vivo evidence that the functional association between Eph and RasGAP controls the spatial extent of FGF-activated ERK.

show abstract

FGF signaling establishes the anterior border of the Ciona neural tube

Cited by 87 publications

References 74 publications

Nodal and FGF coordinate ascidian neural tube morphogenesis

Nodal and FGF coordinate ascidian neural tube morphogenesis

Islet is a key determinant of ascidian palp morphogenesis

p120RasGAP mediates ephrin/Eph-dependent attenuation of FGF/ERK signals during cell fate specification in ascidian embryos

Contact Info

Product

Resources

About