Ferroxitosis: A cell death from modulation of oxidative phosphorylation and PKM2-dependent glycolysis in melanoma

Lakhter, Alexander J.; Hamilton, James; Dagher, Pierre C.; Mukkamala, Suresh; Hato, Takashi; Mayo, Lindsey D.; Harris, Robert A.; Shekhar, Anantha; Ivan, Mircea; Brustovetsky, Nickolay; Naidu, Samisubbu R.

doi:10.18632/oncotarget.3031

Cited by 14 publications

(17 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…ACSS2 knockdown depleted nearly 90% of its transcripts with a small increase in the levels of ACSS1 transcript. To assess the effects of ACSS1 and ACSS2 knockdown on melanoma tumor growth in mice, MEL526 cells were transduced with these lentiviral shRNAs and implanted in NSG mice subcutaneously, as we previously reported (23). Depletion of ACSS1 or ACSS2 significantly reduced the growth of tumors as compared with the control group (Fig.…”

Section: Glutamine But Not Acetate Supports the Viability Of Mutant Nmentioning

confidence: 70%

“…Glucose-independent Acetate Metabolism in Melanoma Involves Oxidative Phosphorylation-Our previous report (23), and studies by others (31,32), suggest that melanoma cells are highly dependent on glycolysis. This led us to hypothesize that glucose-deprivation imposes oxidative phosphorylation (OXPHOS)-dependent acetate metabolism in melanoma cells.…”

Section: Glutamine But Not Acetate Supports the Viability Of Mutant Nmentioning

confidence: 86%

“…Production of viral particles and transduction of target cells was conducted as described elsewhere. Gene expression changes were assessed by RT-qPCR as we previously reported (23), using the following primer sequences: ACSS1 forward, GTGCAGAGTCCTTG-GCTGGG, ACSS1 reverse, TTCTTCAGCTCCACCACGCG, ACSS2 forward, CGAGGCCCTGCAGAAGTGTC, and ACSS2 reverse, GAGTCACCCATGCCGAGCTC.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Glucose-independent Acetate Metabolism Promotes Melanoma Cell Survival and Tumor Growth

Lakhter

Hamilton

Konger

et al. 2016

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

Tumors rely on multiple nutrients to meet cellular bioenergetics and macromolecular synthesis demands of rapidly dividing cells. Although the role of glucose and glutamine in cancer metabolism is well understood, the relative contribution of acetate metabolism remains to be clarified. We show that glutamine supplementation is not sufficient to prevent loss of cell viability in a subset of glucose-deprived melanoma cells, but synergizes with acetate to support cell survival. Glucose-deprived melanoma cells depend on both oxidative phosphorylation and acetate metabolism for cell survival. Acetate supplementation significantly contributed to maintenance of ATP levels in glucose-starved cells. Unlike acetate, short chain fatty acids such as butyrate and propionate failed to prevent loss of cell viability from glucose deprivation. In vivo studies revealed that in addition to nucleo-cytoplasmic acetate assimilating enzyme ACSS2, mitochondrial ACSS1 was critical for melanoma tumor growth in mice. Our data indicate that acetate metabolism may be a potential therapeutic target for BRAF mutant melanoma.Malignant cells undergo metabolic reprograming to fuel proliferation in a nutrient-limited environment. Tumor cells metabolize glucose in the presence of oxygen, a process known as the Warburg effect or aerobic glycolysis (1). The Warburg effect is generally considered as a metabolic hallmark of cancer (2), yet therapeutic targeting of underlying pathways has remained challenging. For example, BRAF inhibitors are the first line therapy for treatment of patients with mutant BRAFdriven melanoma (3). However, rapid development of resistance to these inhibitors involves reduction in glucose uptake and glycolysis (4,5). Recent studies demonstrated that tumor cells are dependent on glutamine metabolism to support cell proliferation (6). Glutamine metabolism enables maintenance of tricarboxylic acid (TCA) 2 cycle intermediates and plays a critical role in suppressing oxidative stress by supplying antioxidants. Although glutamine can synergize with glucose metabolism to support tumor cell proliferation, metabolic tracing studies in glucose-deprived cells revealed that an unknown source of carbon cooperated with glutamine in maintaining TCA cycle intermediates (7). Collectively, these studies suggest that malignant cells rapidly adapt to nutrient limitation by resetting their metabolism to maintain cell proliferation, thus hampering effective treatments.Similar to DNA synthesis, energy production and lipid synthesis are crucial biochemical processes in rapidly dividing cancer cells. Acetyl-CoA, a mitochondrial metabolite responsible for the TCA cycle and energy production is also the primary substrate for lipid synthesis. ATP citrate lyase (ACLY) plays a central role in mobilizing acetyl-CoA from the mitochondria to the cytoplasm. ACLY overexpression is frequently observed in tumors and its inhibition reduces tumor growth (8). Although BRAF inhibitor resistant melanoma shows reduced glucose uptake (4, 5), as opposed to the Warburg e...

show abstract

Section: Glutamine But Not Acetate Supports the Viability Of Mutant Nmentioning

confidence: 70%

Section: Glutamine But Not Acetate Supports the Viability Of Mutant Nmentioning

confidence: 86%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Glucose-independent Acetate Metabolism Promotes Melanoma Cell Survival and Tumor Growth

Lakhter

Hamilton

Konger

et al. 2016

Journal of Biological Chemistry

Self Cite

View full text Add to dashboard Cite

show abstract

“…In addition, ENO1 and ALDOA genes have both hypoxia-responsive elements for HIF1α [59] and PKM2 is upregulated under hypoxia promoting HIF1α transactivation [60]. Interestingly, PKM2 inhibitors (e.g., shikonin), which target oxidative phosphorylation, have been shown to improve the therapeutic effects of combined BRAF/MEK inhibitor [61]. In this context, hepatic stellate cells under hypoxia increase expression of GLUT1 and PKM2, which were enriched in our hEVs.…”

Section: Discussionmentioning

confidence: 82%

Hypoxia-Induced Adaptations of miRNomes and Proteomes in Melanoma Cells and Their Secreted Extracellular Vesicles

Walbrecq

Lecha

Gaigneaux

et al. 2020

Cancers

View full text Add to dashboard Cite

Reduced levels of intratumoural oxygen are associated with hypoxia-induced pro-oncogenic events such as invasion, metabolic reprogramming, epithelial–mesenchymal transition, metastasis and resistance to therapy, all favouring cancer progression. Small extracellular vesicles (EV) shuttle various cargos (proteins, miRNAs, DNA and others). Tumour-derived EVs can be taken up by neighbouring or distant cells in the tumour microenvironment, thus facilitating intercellular communication. The quantity of extracellular vesicle secretion and their composition can vary with changing microenvironmental conditions and disease states. Here, we investigated in melanoma cells the influence of hypoxia on the content and number of secreted EVs. Whole miRNome and proteome profiling revealed distinct expression patterns in normoxic or hypoxic growth conditions. Apart from the well-known miR-210, we identified miR-1290 as a novel hypoxia-associated microRNA, which was highly abundant in hypoxic EVs. On the other hand, miR-23a-5p and -23b-5p were consistently downregulated in hypoxic conditions, while the protein levels of the miR-23a/b-5p-predicted target IPO11 were concomitantly upregulated. Furthermore, hypoxic melanoma EVs exhibit a signature consisting of six proteins (AKR7A2, DDX39B, EIF3C, FARSA, PRMT5, VARS), which were significantly associated with a poor prognosis for melanoma patients, indicating that proteins and/or miRNAs secreted by cancer cells may be exploited as biomarkers.

show abstract

“…In light of our previous report demonstrating that a recurrent glioma mutation found in dimerization domain of HIF1a suppresses mitochondrial respiration [Lakhter et al, 2014], and given the potential role of the ER oxygen levels in oxidative folding of dimerization domain, a better understanding of the this domain in the context of ER-Golgi localization may have implications in patho-physiology of cancer, neurodegenerative diseases and diabetes.…”

Section: Discussionmentioning

confidence: 99%

Golgi Associated HIF1a Serves as a Reserve in Melanoma Cells

Lakhter¹,

Lahm²,

Broxmeyer³

et al. 2015

J of Cellular Biochemistry

Self Cite

View full text Add to dashboard Cite

Hypoxia-inducible factor-1alpha (HIF1a) is a key transcriptional regulator that enables cellular metabolic adaptation to low levels of oxygen. Multiple mechanisms, including lysosomal degradation, control the levels of HIF1a protein. Here we show that HIF1a protein degradation is resistant to lysosomal inhibition and that HIF1a is associated with the Golgi compartment in melanoma cells. Although pharmacological inhibitors of prolyl hydroxylation, neddylation and the proteasome inhibited degradation of HIF1a, attenuation of lysosomal activity with chloroquine did not alter the levels of HIF1a or its association with Golgi. Pharmacological disruption of Golgi resulted in nuclear accumulation of HIF1a. However, blockade of ER-Golgi protein transport in hypoxia reduced the transcript levels of HIF1a target genes. These findings suggest a possible role for the oxygen-dependent protein folding process from the ER-Golgi compartment in fine-tuning HIF1a transcriptional output.

show abstract

Ferroxitosis: A cell death from modulation of oxidative phosphorylation and PKM2-dependent glycolysis in melanoma

Cited by 14 publications

References 39 publications

Glucose-independent Acetate Metabolism Promotes Melanoma Cell Survival and Tumor Growth

Glucose-independent Acetate Metabolism Promotes Melanoma Cell Survival and Tumor Growth

Hypoxia-Induced Adaptations of miRNomes and Proteomes in Melanoma Cells and Their Secreted Extracellular Vesicles

Golgi Associated HIF1a Serves as a Reserve in Melanoma Cells

Contact Info

Product

Resources

About