Farnesoid X Receptor Plays a Key Role in Ochratoxin A-Induced Nephrotoxicity by Targeting Ferroptosis In Vivo and In Vitro

Tang, Jiangyu; Zeng, Junya; Chen, Li; Wang, Mengmeng; He, Suibin; Muhmood, Azhar; Chen, Xingxiang; Huang, Kehe; Gan, Fang

doi:10.1021/acs.jafc.3c04560

Cited by 9 publications

(4 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our results showed that with the increase in OTA dose, the mRNA expressions of ferritin, FTH, TFR1, SLC7A11, GPX4, and Nrf2 and the protein expressions of FTH, GPX4, XCT, TFR1, and nuclear-Nrf2 were significantly reduced in the muscle and GCPMs. This was consistent with studies in HK-2 cells, where OTA inhibited gene and protein expressions of GPX4 and FTH . Studies on other fungal toxins have shown that 0.5 μg/mL DON treatment reduced TFR1 expression in IPEC-J2 cells for 48 h .…”

Section: Discussionsupporting

confidence: 89%

“…Our previous research has shown that OTA causes myotoxicity by causing oxidative damage . Recent studies have shown that OTA-induced oxidative damage is associated with ferroptosis . Based on this, we propose a scientific hypothesis that OTA can also cause iron death in GCPMs.…”

Section: Discussionmentioning

confidence: 92%

“…There were reports that oxidative stress induced lipid peroxidation and led to iron deposition . Currently, only one article has found that OTA induces ferroptosis by increasing unstable iron pool and lipid peroxidation levels and reducing glutathione peroxidase 4 (GPX4) and ferritin heavy chain (FTH) mRNA and protein expression . Ferroptosis is a nonapoptotic cell death caused by the accumulation of iron-dependent lipid peroxides .…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Novel Perspective on Mechanism in Muscle Growth Inhibited by Ochratoxin A Associated with Ferroptosis: Model of Juvenile Grass Carp (Ctenopharyngodon idella) In Vivo and In Vitro Trials

Zhao,

Zhang,

Feng

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

Ochratoxin A (OTA) is a common mycotoxin in food and feed that seriously harms human and animal health. This study investigated the effect of OTA on the muscle growth of juvenile grass carp (Ctenopharyngodon idella) and its possible mechanism in vitro. Our results have the following innovative findings: (1) Dietary OTA increased the expression of increasing phase I metabolic enzymes and absorbing transporters while reducing the expression of efflux transporters, thereby increasing their residue in muscles; (2) OTA inhibited the expressions of cell cycle and myogenic regulatory factors (MyoD, MyoG, and MyHC) and induced ferroptosis by decreasing the mRNA and protein expressions of FTH, TFR1, GPX4, and Nrf2 both in vivo and in vitro; and (3) the addition of DFO improved OTA-induced ferroptosis of grass carp primary myoblasts and promoted cell proliferation, while the addition of AKT improved OTA-inhibited myoblast differentiation and fusion, thus inhibiting muscle growth. Overall, this study provides a potential research target to further mitigate the myotoxicity of OTA.

show abstract

Section: Discussionsupporting

confidence: 89%

Section: Discussionmentioning

confidence: 92%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Novel Perspective on Mechanism in Muscle Growth Inhibited by Ochratoxin A Associated with Ferroptosis: Model of Juvenile Grass Carp (Ctenopharyngodon idella) In Vivo and In Vitro Trials

Zhao,

Zhang,

Feng

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

show abstract

“…Ochratoxin A (OTA) is a toxic secondary metabolite mainly produced by Penicillium verrucosum and Aspergillus carbosporus and is present in foods such as cereals, grapes, coffee, spices, and cocoa. − OTA has cumulative toxicity, so animals ingesting feed contaminated with OTA may result in OTA residues in animal-derived foods, further affecting human health throughout the food chain. − Therefore, it is always necessary to establish an analysis method that is simple, fast, and sustainable and can be directly detected at the sampling location.…”

Section: Introductionmentioning

confidence: 99%

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

Dong,

Qi,

et al. 2024

J. Agric. Food Chem.

View full text Add to dashboard Cite

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the −17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

show abstract

Ochratoxin A induces hepatic and renal toxicity in mice through increased oxidative stress, mitochondrial damage, and multiple cell death mechanisms

Son,

Lee,

Ryu

et al. 2024

Arch Toxicol

View full text Add to dashboard Cite

Farnesoid X Receptor Plays a Key Role in Ochratoxin A-Induced Nephrotoxicity by Targeting Ferroptosis In Vivo and In Vitro

Cited by 9 publications

References 55 publications

Novel Perspective on Mechanism in Muscle Growth Inhibited by Ochratoxin A Associated with Ferroptosis: Model of Juvenile Grass Carp (Ctenopharyngodon idella) In Vivo and In Vitro Trials

Novel Perspective on Mechanism in Muscle Growth Inhibited by Ochratoxin A Associated with Ferroptosis: Model of Juvenile Grass Carp (Ctenopharyngodon idella) In Vivo and In Vitro Trials

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor

Ochratoxin A induces hepatic and renal toxicity in mice through increased oxidative stress, mitochondrial damage, and multiple cell death mechanisms

Contact Info

Product

Resources

About