Far upstream element binding protein 1 binds the internal ribosomal entry site of enterovirus 71 and enhances viral translation and viral growth

Abstract

Enterovirus 71 (EV71) is associated with severe neurological disorders in children, and has been implicated as the infectious agent in several large-scale outbreaks with mortalities. Upon infection, the viral RNA is translated in a cap-independent manner to yield a large polyprotein precursor. This mechanism relies on the presence of an internal ribosome entry site (IRES) element within the 5′-untranslated region. Virus–host interactions in EV71-infected cells are crucial in assisting this process. We identified a novel positive IRES trans-acting factor, far upstream element binding protein 1 (FBP1). Using binding assays, we mapped the RNA determinants within the EV71 IRES responsible for FBP1 binding and mapped the protein domains involved in this interaction. We also demonstrated that during EV71 infection, the nuclear protein FBP1 is enriched in cytoplasm where viral replication occurs. Moreover, we showed that FBP1 acts as a positive regulator of EV71 replication by competing with negative ITAF for EV71 IRES binding. These new findings may provide a route to new anti-viral therapy.

Picornavirus IRES elements: RNA structure and host protein interactions

“…One of the first reported examples was nucleolin (Waggoner and Sarnow, 1998) that interacts with HAV, EMCV and PV IRES (Kim and Jang, 1999). Recent studies have shown the localization in the cytoplasm of infected cells of several ITAFs, as illustrated by far upstream element binding protein 1 (FBPI) (Huang et al, 2011) or hnRNP A (Lin et al, 2009b). Redistribution of SRp20 to the cytoplasm of infected cells (Fitzgerald et al, 2013;Fitzgerald and Semler, 2011) is consistent with their capacity to stimulate enterovirus 71 (EV71) or PV IRES activity (Bedard et al, 2007).…”

The Splicing Factor FUBP1 Is Required for the Efficient Splicing of Oncogene MDM2 Pre-mRNA

“…Functionally, FUBP1 is a DNA helicase V (31) and is best known for its role in the transcriptional up-regulation of c-MYC through its binding of single-stranded DNA at the far upstream element (32) via the four tandem K homology motifs in its central domain (33,34). However, it is capable of binding singlestranded RNA and post-transcriptional functions have been described for FUBP1 in mRNA turnover and translation control (35)(36)(37)(38). Although a close family member FUBP2 (KHSRP) is a known splicing regulator (39), FUBP1 itself had previously not been implicated in splicing despite the fact that its presence had been identified in the spliceosomal complex (40).…”

Enterovirus 71 Infection Cleaves a Negative Regulator for Viral Internal Ribosomal Entry Site-Driven Translation

“…Proteins that bind to the IRES and regulate translation by affecting ribosome recruitment or by changing the structure of the IRES are called IRES trans-acting factors (ITAFs). PTB (29,30), poly(rC)-binding protein 1 (PCBP1), PCBP2 (31), autoantigen La (32), upstream N-ras protein (Unr) (33), far-upstream element (FUSE) binding protein 1 (FBP1) (34), and FBP2 (35) are all ITAFs of picornaviruses (36).…”

“…The reverse primers contained 6 His sequences. PCR products were inserted into the pBacPAK8-MTEGFP vector (Tsu-An Hsu, National Health Research Institute, MiaoLi, Taiwan) using XhoI and EcoRI sites (34). The cDNA corresponding to amino acids 1 to 503 of FBP2 was amplified using PCR with primers 5=-GAATTCGCCACCATGAGCGAC TACAGCACAGGCGGA and 5=-CCCCTCGAGTCAATGATGATGATG ATGGTGTCCAACTGGGCAGAG; the reverse primer contained 6 His sequences.…”