Facile Synthesis, Geometry, and 2′-Substituent-Dependent in Vivo Activity of 5′-(E)- and 5′-(Z)-Vinylphosphonate-Modified siRNA Conjugates

Abstract

(E)-Vinylphosphonate ((E)-VP), a metabolically stable phosphate mimic at the 5'-end of the antisense strand, enhances the in vivo potency of siRNA. Here we describe a straightforward synthetic approach to incorporate a nucleotide carrying a vinylphosphonate (VP) moiety at the 5'-end of oligonucleotides under standard solid-phase synthesis and deprotection conditions by utilizing pivaloyloxymethyl (POM) protected VP-nucleoside phosphoramidites. The POM protection enhances scope and scalability of 5'-VP-modified oligonucleotides and, in a broader sense, the synthesis of oligonucleotides modified with phosphonate moieties. Trivalent N-acetylgalactosamine-conjugated small interfering RNA (GalNAc-siRNA) comprising (E)-geometrical isomer of VP showed improved RISC loading with robust RNAi-mediated gene silencing in mice compared to the corresponding (Z)-isomer despite similar tissue accumulation. We also obtained structural insights into why bulkier 2'-ribosugar substitutions such as 2'-O-[2-(methylamino)-2-oxoethyl] are well tolerated only when combined with 5'-(E)-VP.

Synthesis and evaluation of (S)-5′-C-aminopropyl and (S)-5′-C-aminopropyl-2′-arabinofluoro modified DNA oligomers for novel RNase H-dependent antisense oligonucleotides

“…As a result of the NOESY measurements, the NOE was observed between H-3 0 and H-5 0 of 21, but not in 20, which suggests that compound 11, the main product generated by Hosomi-Sakurai allylation, was the desired (S)-isomer, while compound 12 was the other isomer. 15,24 This conclusions from NOESY measurements were consistent with the results of 1 H NMR; the spin-spin coupling constant between H-4 0 and H-5 0 was measured as 1.84 Hz in 20 and 9.16 Hz in 21, which suggested the conformation of H-4 0 and H-5 0 were of the gauche-and anti-form, respectively. The pure (S)-isomer 11 was then converted into compound 13 by hydroboration and oxidation of the allyl moiety, followed by site-selective tosylation of the 5 0 -hydroxy function to give compound 14 in 81% yield.…”

Structural basis for the synergy of 4′- and 2′-modifications on siRNA nuclease resistance, thermal stability and RNAi activity

“…Compound 2 . To a solution of compound 1 (20.00 g, 53.70 mmol) ( 22 ) in anhydrous THF (280 ml) were added PPh 3 (16.8 g, 64.1 mmol), imidazole (7.60 g, 111.60 mmol), and I 2 (16.40 g, 64.60 mmol) at 0°C. The reaction mixture was stirred at room temperature for 19 h. Additional PPh 3 (4.23 g, 16.10 mmol), imidazole (1.83 g, 26.90 mmol) and I 2 (4.09 g, 16.10 mmol) were added and the mixture was allowed to stir for 1 h. The reaction was quenched by 10% aqueous sodium thiosulfate solution (30 ml).…”

No evidence for brain renin–angiotensin system activation during DOCA-salt hypertension

“…siRNA quantification was performed as described previously. 27 Antisense levels in siRNA standard curve dilutions and homogenized liver, kidney and cerebellum samples were quantified by stem loop reverse transcription followed by qPCR. The primer and probe sequences were GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGCTATCCT System (Bio-Rad).…”