Extraction of bulk DNA from Thar Desert soils for optimization of PCR-DGGE based microbial community analysis

Gothwal, Raj Kumar; Nigam, Vinod Kumar; Mohan, M. Krishna; Sasmal, D.; Ghosh, Purnendu

doi:10.2225/vol10-issue3-fulltext-6

Cited by 21 publications

(14 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Soil fertility can be enhanced through the concept of using, improving and restoring the symbiotic rhizobia [86]. The fact that rhizobia inoculants are inexpensive source of biofertilizers, is a means for sustainable legume supply to the growing population hence is environmental friendly [87].…”

Section: Nitrogen Fixation and Crop Productivitymentioning

confidence: 99%

See 1 more Smart Citation

Isolation and Characterization of Nitrogen Fixing Rhizobia from Cultivated and Uncultivated Soils of Northern Tanzania

Simon¹,

Mtei²,

Gessesse³

et al. 2014

AJPS

View full text Add to dashboard Cite

Soil bacteria 1 called rhizobia are gram-negative capable to colonize the soil immediately surrounding roots under the influence of the plant "rhizosphere" and reduce atmospheric nitrogen into the form available to plants through nitrogen fixation process. Nitrogen is the most limiting and supplied nutrient to most plants, and the determinant of plant growth. Legumes differ with most plants because they have access to nitrogen from both mineral and symbiotic sources. Small-scale farmers who are the major legume producers in Africa rarely apply fertilizers during legume production. Hence, the crop is largely dependent on fixed nitrogen from native nitrogen fixers. Isolation of rhizobia for legume production has been given a little attention in Africa due to inadequate research or negligence of researchers and unawareness of its potential in legume production as well as lack of an intention from skilled personnel to popularize the technology. Evaluation of effectiveness of isolated rhizobia is essential for inoculants preparation, host specificity recommendation and symbiotic effectiveness. The isolation, determination of their population in the soil and assessing factors affecting their population and testing the effectiveness of native nitrogen fixers with respect to right trap host crop are given a special attention in this review.

show abstract

Section: Nitrogen Fixation and Crop Productivitymentioning

confidence: 99%

“…The system is estimated to contribute 1.44 × 10 8 metric tons of nitrogen per year globally [158]. The application of nitrogen fertilizers in Kenya was reported to increase the dry matter and grain yield in common beans (Phaseolus vulgaris) but led to decreased number of nodules per plant.…”

Section: Evaluation Of the Nitrogen Fixing Capability Of Isolated Strmentioning

confidence: 99%

Isolation and Characterization of Nitrogen Fixing Rhizobia from Cultivated and Uncultivated Soils of Northern Tanzania

Simon¹,

Mtei²,

Gessesse³

et al. 2014

AJPS

View full text Add to dashboard Cite

show abstract

“…The PCR amplification of 16S ribosomal RNA gene was carried out at Kamini Research Foundation, Thuckalay, Nagercoil by following the methodology as described by Gothwal et al . [13] using Thermal cycler (Gene AMP 2720 – Applied Biosystem). Primers: Forward:'AACGGCTCACCAAGGCGACG 3'; Reverse: 5' GTACCGTCAAGGTGCCGCCC 3'.…”

Section: Methodsmentioning

confidence: 99%

Characterization and phylogenetic analysis of antituberculous compound producing actinomycete strain D25 isolated from Thar Desert soil, Rajasthan

Radhakrishnan

Gopikrishnan²,

Suresh³

et al. 2013

Bioinformation

View full text Add to dashboard Cite

During the course of the anti-infective drug discovery programme, actinomycete strain D25 was recovered from the Thar Desert soil, Rajasthan, India. Actinomycin type of compound isolated from the strain D25 showed promising activity against multi drug resistant and extensively drug resistant M. tuberculosis isolates. The present study reports the characteristics and phylogenetic status of the actinomycete strain D25. Phenotypic and cell wall characteristics revealed that the strain belongs to the genus Streptomyces. Further 16s rRNA analysis confined the genus Streptomyces with 97% similarity to the closely related species Streptomyces althioticus KCTC 9752. The 16s rRNA sequence was submitted to GenBank with the accession number JN604533.1. According to Bossard et al. (2003) strain D25 was found to be a novel species of the genus Streptomyces from Thar Desert soil, Rajasthan.

show abstract

“…DNA extraction was performed according to the method of Gothwal et al (2007). Several DNA extractions of the same sample were carried out simultaneously, and the resulting DNAs were pooled.…”

Section: Molecular Analysismentioning

confidence: 99%

“…PCR amplification was conducted in a Bio-Rad Gradient Thermal Cycler and the amplification program was as follows: initial denaturation of DNA for 5 min at 941C; 30 cycles of 1.5 min at 941C, 1 min at 551C, and 1.5 min at 721C; followed by a final extension for 10 min at 721C. PCR products were used as the templates for the V3 region nested amplification with the primers BSF338/ BSR518 (Gothwal et al 2007). PCR mixtures were 1U Taq DNA polymerase, 5 mL of the corresponding 10 Â buffer with MgCl 2 , 4 mL of 25 mM dNTP mixture of TaKaRa, 1 uL template DNA about 10 ng, 1 mL each primer and sterile water in a final volume of 50 mL.…”

Section: Molecular Analysismentioning

confidence: 99%

Analysis of the bacterial community changes in soil for septic tank effluent treatment in response to bio-clogging

Nie

Zhu

Zhao

et al. 2011

Water Science and Technology

View full text Add to dashboard Cite

Soil columns were set up to survey the bacterial community in the soil for septic tank effluent treatment. When bio-clogging occurred in the soil columns, the effluent from the columns was in poorer quality. To evaluate changes of the soil bacterial community in response to bio-clogging, the bacterial community was characterized by DNA gene sequences from soil samples after polymerase chain reaction coupled with denaturing gradient gel electrophoresis process. Correspondence analysis showed that Proteobacteria related bacteria were the main bacteria within the soil when treating septic tank effluent. However, Betaproteobacteria related bacteria were the dominant microorganisms in the normal soil, whereas Alphaproteobacteria related bacteria were more abundant in the clogged soil. This study provided insight into changes of the soil bacterial community in response to bio-clogging. The results can supply some useful information for the design and management of soil infiltration systems.

show abstract

Extraction of bulk DNA from Thar Desert soils for optimization of PCR-DGGE based microbial community analysis

Cited by 21 publications

References 11 publications

Isolation and Characterization of Nitrogen Fixing Rhizobia from Cultivated and Uncultivated Soils of Northern Tanzania

Isolation and Characterization of Nitrogen Fixing Rhizobia from Cultivated and Uncultivated Soils of Northern Tanzania

Characterization and phylogenetic analysis of antituberculous compound producing actinomycete strain D25 isolated from Thar Desert soil, Rajasthan

Analysis of the bacterial community changes in soil for septic tank effluent treatment in response to bio-clogging

Contact Info

Product

Resources

About