Expression profiling of miR-96, miR-584 and miR-422a in colon cancer and their potential involvement in colon cancer pathogenesis

Abstract

Purpose: To determine the correlation between miRNAs; miR-96, miR-422a and miR584, and colon cancer, and

TGF‐β1 induces amoeboid‐to‐mesenchymal transition of CD44high oral squamous cell carcinoma cells via miR‐422a downregulation through ERK activation and Cofilin‐1 phosphorylation

“…The PCR protocol was as follows: initial denaturation at 95°C for 10 minutes followed by 40 cycles of 95°C for 30 seconds, 57°C for 30 seconds and 72°C for 30 seconds. The following PCR primer sets were used: Cofilin‐1 :5′‐GCCGCTATGCCCTCTA‐3′ (sense), 5′‐CAATTCATGCTTGATCCCT‐3′ (antisense) 12 ; Vimentin : 5′‐CCCTCACCTGTGAAGTGGAT‐3′ (sense), 5′‐GACGAGCCATTTCCTCCTTC‐3′ (antisense) 7 ; N‐cadherin : 5′‐GCCCCTCAAGTGTTACCTCAA‐3′ (sense), 5′‐AGCCGAGTGATGGTCCAATTT‐3′ (antisense) 13 ; Snail : 5′‐CAAGGAATACCTCAGCCTGG‐3′ (sense), 5′‐CATCTGAGTGGGTCTGGAGG‐3′ (antisense) 11 ; E‐cadherin : 5′‐GAACGCATTGCCACATACAC‐3′ (sense), 5′‐AGCACCTTCCATGACAGACC‐3′ (antisense) 7 ; ERK1 : 5′‐CGCTTCCGCCATGAGAATGTC‐3′ (sense), 5′‐CAGGTCAGTCTCCATCAGGTCCTG‐3′ (antisense) 14 ; ERK2 : 5′‐GAAGACACAGCACCTCAGCAA‐3′ (sense), 5′‐TGGAAGGCTTGAGGTCACGGT‐3′ (antisense) 15 ; GAPDH : 5′‐GTGAACCATGAGAAGTATGACAAC‐3′ (sense), 5′‐ATGAGTCCTTCCACGATACC‐3′ (antisense), 7 miR‐422a: 5′‐ GCTCCCATGCTATTAATATTCCTGGA −3′ (sense), 5′‐ CGATCGCGCTTCAGCTCA −3′ (antisense), 16 U6: 5′‐ GCTTCGGCAGCACATATACTAAAAT −3′ (sense), 5′‐ CGCTTCACGAATTTGCGTGTCAT −3′ (antisense) 17 . GAPDH was used as an internal control to normalize target gene expression.…”