Expression of Viral microRNAs in Serum and White Blood Cells of Cows Exposed to Bovine Leukemia Virus

Abstract

Bovine leukemia virus (BLV) affects the health and productivity of cattle. The virus causes abnormal immune function and immunosuppression. MicroRNAs (miRNAs) are involved in gene expression, having been associated with stress and immune response, tumor growth, and viral infection. The objective of this study was to determine the expression of circulating miRNAs produced by BLV in animals exposed to the virus. Sera from 14 animals were collected to establish IgG reactivity to BLV by ELISA, where seven animals were seropositive and seven were seronegative for BLV exposure. White blood cells (WBC) from each animal were also collected and miRNAs were identified by sequencing from sera and WBC. The seropositive group had higher counts of BLV miRNAs when compared to seronegative group in sera and WBC. Blv-miR-1-3p, blv-miR-B2-5p, blv-miR-B4-3p, and blv-miR-B5-5p were statistically significant (P < 0.00001) in serum with an average of 7 log2 fold difference between seropositive and seronegative groups. Blv-miR-B1-3p, blv-miR-B1-5p, blv-miR-B3, blv-miR-B4-3p, blv-miR-B4-5p, blv-miR-B5-5p were statistically significant (P < 1.08e −9) in WBC with an average of 7 log2 fold difference between the seropositive and the seronegative groups. Blv-miR-B2-3p and blv-miR-B2-5p were also statistically significant in WBC (P < 2.79e-17), with an average of 27 log2 fold difference between the seropositive and the seronegative groups. There were 18 genes identified as being potential targets for blv-miR-B1-5p, and 3 genes for blv-miR-B4-5p. Gene ontology analysis indicated that the target genes are mainly involved in the response to stress and in the immune system process. Several of the identified genes have been associated with leukemia development in humans and cattle. Differential expression of genes targeted by BLV miRNAs should be evaluated to determine their effect in BLV replication.

Bovine leukemia virus encoded blv-miR-b4-3p microRNA is associated with reduced expression of anti-oncogenic gene in vivo

“…Particularly, blv-mir-b4-3p mimics host miRNA mir-29a, a suspected oncomiR targeting PXDN and HBP-1. Interestingly, PXDN and HBP-1 have been involved with B-cell tumor suppression in different model organisms (i.e., mice) and humans [ 7 , 11 – 13 ]. Differential expression of such target genes in vivo during natural infection with BLV remains largely unexplored.…”

“…different model organisms (i.e., mice) and humans [7,[11][12][13]. Differential expression of such target genes in vivo during natural infection with BLV remains largely unexplored.…”

“…Although the production of viral proteins is abolished during the chronic stage, viral transcription is not completely shut down. Different groups have shown that BLV genome encodes for different micro-RNAs (miRNAs) which have the potential to regulate different host metabolic routes and modulate pathogenesis [4][5][6][7][8][9]. miRNAs are small (19-24 bases) non-coding RNAs with posttranscriptional regulatory capacity [10].…”

Influence of Maternal BLV Infection on miRNA and tRF Expression in Calves

“…Adapter sequence (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) was removed from the raw sequencing reads by using cutadapt v1. 18. Reads with low quality bases (Phred score < 20) were trimmed using the dynamictrim function of SolexaQA++ v3.1.7.1 [35].…”

“…Furthermore, the literature demonstrates that placental small non-coding RNAs, such as miRNAs, can move through maternal circulation and be trafficked to the placenta and fetal compartment, and vice versa, placental RNAs can be transmitted to maternal plasma [13][14][15]. While there is existing evidence demonstrating a relationship between miRNA, tRFs, and Bovine Leukemia Virus (BLV), the literature exploring the potential effects of dam BLV infection on its offspring is nonexistent [16][17][18].…”