Expression of transcriptional factor EB (TFEB) in differentiating spermatogonia potentially promotes cell migration in mouse seminiferous epithelium

Abstract

BackgroundSpermatogenesis is a complex process involving the self-renewal and differentiation of spermatogonia into mature spermatids in the seminiferous tubules. During spermatogenesis, germ cells migrate from the basement membrane to cross the blood-testis barrier (BTB) and finally reach the luminal side of the seminiferous epithelium. However, the mechanism for regulating the migration of germ cells remains unclear. In this study, we focused on the expression and function of transcriptional factor EB (TFEB), a master regulator of lysosomal biogenesis, autophagy and endocytosis, in spermatogenesis.MethodsThe expression pattern of the TFEB in mouse testes were investigated by Western blotting and immunohistochemistry analyses. Either undifferentiated spermatogonia or differentiating spermatogonia were isolated from testes using magnetic-activated cell sorting based on specific cell surface markers. Differentiation of spermatogonia was induced with 100 nM retinoic acid (RA). shRNA was used to knock down TFEB in cells. TFEB expression was detected by immunofluorescence, qRT-PCR, and Western blotting. Cell migration was determined by both transwell migration assay and wound healing assay applied to a cell line of immortalized spermatogonia, GC-1 cells.ResultsDuring testicular development, TFEB expression was rapidly increased in the testes at the period of 7 days post-partum (dpp) to 14 dpp, whereas in adult testis, it was predominantly localized in the nucleus of spermatogonia at stages VI to VIII of the seminiferous epithelial cycle. Accordingly, TFEB was observed to be mainly expressed in differentiating spermatogonia and was activated for nuclear translocation by RA treatment. Moreover, knockdown of TFEB expression by RNAi did not affect spermatogonial differentiation, but significantly reduced cell migration in GC-1 cells.ConclusionThese findings imply that regionally distinct expression and activation of TFEB was strongly associated with RA signaling, and therefore may promote cell migration across the BTB and transport along the seminiferous epithelium.Electronic supplementary materialThe online version of this article (10.1186/s12958-018-0427-x) contains supplementary material, which is available to authorized users.

Accelerating Onset of Puberty Through Modification of Early Life Nutrition Induces Modest but Persistent Changes in Bull Sperm DNA Methylation Profiles Post-puberty

“…TFEB encodes a transcription factor that activates the transcription of many genes involved in lysosome biogenesis and autophagy and its expression is tightly regulated during spermatogenesis. During the differentiation of spermatogonia, the activation of autophagy by TFEB facilitates migration towards the lumen of seminiferous tubules through the recycling of adhesion molecules, receptor and matrix proteins (Liu et al, 2018). In contrast, the induction of the meiosis gatekeeper STRA8 at the onset of meiosis is associated with a repression of autophagy and with ULK1 and TFEB downregulation (Ferder et al, 2019).…”

Proteomic alterations underlie an association with teratozoospermia in obese mice sperm

“…For proteomic analysis, sperm samples were collected from caudal epididymes by centrifugation in a 45% Percoll gradient (GE Healthcare, Waukesha, WI, USA) (800 g, 20 min, 4 °C) and then washed thrice with PBS. Six samples from the CD group and six samples from the HFD group were prepared for liquid chromatography tandem mass spectrometry (LC-MS) and performed as described [18]. All MS/MS spectra were searched using Proteome Discoverer 2.2 software against the mouse UniProt database and two missing cleavage sites were allowed.…”

“…Western blot analyses were performed as modified as described before [18]. Testicular protein was separated by using 12% denaturing polyacrylamide gels after extracting and determining the concentration, then the protein was transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Germany).…”

Functional importance of palmitoyl protein thioesterase 1 (PPT1) expression by Sertoli cells in mediating cholesterol metabolism and maintenance of sperm quality

“…Sertoli cell isolation was carried out as described (Liu, Hu, Wang, & Xu, ). Briefly, testes of adult mice were decapsulated in Hanks’ Balanced Salt Solution (HBSS) containing collagenase (1 mg/ml, Ref: 17100‐017; Gibco, Carlsbad, CA) for 20 min and seminiferous tubules were collected by sedimentation.…”

“…Primers were synthesized by Sangon Biotech (Shanghai, China) and their sequences were as follows. Ppt1 , forward 5′‐GGGAAGAACATGATGGAGGAT‐3′, reverse 5′‐CTGGGAGAAGCCAATAGCA‐3′; ActB , forward 5′‐CCAGTTCGCCATGGATGACGATAT‐3′, reverse 5′‐GTCAGGATACCTCTCTTGCTCTG‐3′ (Liu et al, ). PCR conditions were set as follows: 5 min at 95°C, followed by 40 cycles at 95°C for 15 s, 60°C for 34 s. The expression level of each gene was normalized to that of the actin, beta (Actb) gene and calculated with the method.…”