Expression of osteocalcin and its transcriptional regulators core‐binding factor alpha 1 and MSX2 in osteoid‐forming tumours

Abstract

Osteosarcoma, fibrous dysplasia, and myositis ossificans contain osteoid-producing cells that are not necessarily morphologically typical osteoblasts. Nevertheless, these pathologic cells may share differentiation steps with osteoblasts at the molecular level. Osteocalcin, a bone-specific extracellular matrix protein, is a marker of mature osteoblasts. Osteocalcin is upregulated by the transcription factor core-binding factor alpha 1, which is responsible for commitment to the osteoblastic lineage, and is downregulated by MSX2, a homeobox-containing transcription factor expressed during the early proliferative phase of osteoblast differentiation. Semiquantitative reverse transcription-polymerase chain reaction was used to compare expression levels of osteocalcin, core-binding factor alpha 1, and MSX2 in 34 osteosarcoma, five fibrous dysplasia, and five myositis ossificans specimens, as well as in seven normal cortical bone samples. Despite normal or elevated levels of core-binding factor alpha-1 expression in most specimens, osteocalcin expression was low or undetectable in most cases of osteosarcoma (25 of 34) and myositis ossificans (4 of 5). Single-strand conformation polymorphism and sequencing did not identify any mutations in the DNA-binding domain of core-binding factor alpha 1. However, a high level of MSX2 expression was demonstrated in these lesions, which may inhibit osteocalcin transcription. The presence of moderate levels of osteocalcin in fibrous dysplasia may contribute to the characteristic disconnected appearance of trabeculae in that entity because osteocalcin is a negative regulator of bone formation.

Regulation of Osteocalcin Gene Expression by a Novel Ku Antigen Transcription Factor Complex

“…The regulation of Ku activities by Msx2 during DNA repair (55), Werner protein RecQ helicase stimulation (56,57), and telomerase targeting (58) have yet to be examined. If regulated by the osteoblast homeoproteins, these latter activities may contribute to the net actions of Msx2 on skeletal growth, osteoblast senescence, and sarcomatous transformation (59,60).…”

Genetic deletion of receptor for hyaluronan-mediated motility (Rhamm) attenuates the formation of aggressive fibromatosis (desmoid tumor)

“…Expression at the RNA level was determined utilizing RT-PCR as previously described (Wang et al, 1998), using the primer pair GCAAACACTGGATGAGCTTGA and TGGTCTGCTGATCTAGAAGCA, which produces a 416 bp product. PCR was performed in a semiquantitative manner, with amplification in the linear range at 28, 31 and 34 cycles with GAPDH as a control as previously reported (Hopyan et al, 1999). Both primer pairs were amplified in the same tube.…”

The impact of osteoblastic differentiation on osteosarcomagenesis in the mouse

“…Osteosarcomas have been evaluated for their expression of osteoblast differentiation marker genes 18 . These marker gene profiles locate most osteosarcomas on the range of osteoblast differentiation at a point near pre-osteoblasts, expressing some lineage-committed markers, but often lacking expression of the markers of terminal differentiation and cell cycle exit, such as osteocalcin 18 - 20 .…”

“…Osteosarcomas have been evaluated for their expression of osteoblast differentiation marker genes 18 . These marker gene profiles locate most osteosarcomas on the range of osteoblast differentiation at a point near pre-osteoblasts, expressing some lineage-committed markers, but often lacking expression of the markers of terminal differentiation and cell cycle exit, such as osteocalcin 18 - 20 . Given this observation, as well as the widely variable differentiation state of the bulk of neoplastic cells in osteosarcomas, many have debated whether the cell of origin or the transforming events themselves contribute more to the final differentiation state of the tumor 14 .…”