Expression of myogenin during embryogenesis is controlled by Six/
            <i>sine oculis</i>
            homeoproteins through a conserved MEF3 binding site

Spitz, François; Demignon, Josiane; Porteu, Arlette; Kahn, Axel; Concordet, Jean‐Paul; Daegelen, Dominique; Maire, Pascal

doi:10.1073/pnas.95.24.14220

Cited by 207 publications

(214 citation statements)

References 40 publications

(43 reference statements)

Supporting

Mentioning

202

Contrasting

Unclassified

Order By: Relevance

“…Of interest, Six1 has recently been shown to activate the Myogenin promoter (27). When we investigated ARMS cells for the presence of HSIX1, we found high expression in all five of the ARMS cell lines tested, as predicted by our results in the NIH 3T3 model.…”

Section: Induction Of a Myogenic Transcription Program By Pax3-fkhrsupporting

confidence: 57%

cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene

et al. 1999

View full text Add to dashboard Cite

Alveolar rhabdomyosarcoma is an aggressive pediatric cancer of striated muscle characterized in 60% of cases by a t(2;13)(q35;q14). This results in the fusion of PAX3, a developmental transcription factor required for limb myogenesis, with FKHR, a member of the forkhead family of transcription factors. The resultant PAX3-FKHR gene possesses transforming properties; however, the effects of this chimeric oncogene on gene expression are largely unknown. To investigate the actions of these transcription factors, both Pax3 and PAX3-FKHR were introduced into NIH 3T3 cells, and the resultant gene expression changes were analyzed with a murine cDNA microarray containing 2,225 elements. We found that PAX3-FKHR but not PAX3 activated a myogenic transcription program including the induction of transcription factors MyoD, Myogenin, Six1, and Slug as well as a battery of genes involved in several aspects of muscle function. Notable among this group were the growth factor gene Igf2 and its binding protein Igfbp5. Relevance of this model was suggested by verification that three of these genes (IGFBP5, HSIX1, and Slug) were also expressed in alveolar rhabdomyosarcoma cell lines. This study utilizes cDNA microarrays to elucidate the pattern of gene expression induced by an oncogenic transcription factor and demonstrates the profound myogenic properties of PAX3-FKHR in NIH 3T3 cells.

show abstract

Section: Induction Of a Myogenic Transcription Program By Pax3-fkhrsupporting

confidence: 57%

cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene

et al. 1999

View full text Add to dashboard Cite

show abstract

“…A 181-bp fragment of the DNA fragment (BamHI-EcoRI fragment of the myogenin luciferase reporter pGL3-6ϫMEF3) containing six repeats of the myogenin MEF3 site TATGTCAGGGGCTTCAGGTTTCCCTA (19) was labeled with [ 32 P]dATP and used as a probe. GST-fusion proteins of Six1 wild type or its mutants were induced by adding 1 mM isopropyl ␤-D-thiogalactoside (IPTG), then purified on glutathione-agarose beads (Molecular Probes) and eluted from the beads following the manufacturer's protocol.…”

Section: Methodsmentioning

confidence: 99%

SIX1 mutations cause branchio-oto-renal syndrome by disruption of EYA1–SIX1–DNA complexes

Ruf

Silvius

et al. 2004

Proc. Natl. Acad. Sci. U.S.A.

381

379

View full text Add to dashboard Cite

Urinary tract malformations constitute the most frequent cause of chronic renal failure in the first two decades of life. Branchio-otic (BO) syndrome is an autosomal dominant developmental disorder characterized by hearing loss. In branchio-oto-renal (BOR) syndrome, malformations of the kidney or urinary tract are associated. Haploinsufficiency for the human gene EYA1, a homologue of the Drosophila gene eyes absent (eya), causes BOR and BO syndromes. We recently mapped a locus for BOR͞BO syndrome (BOS3) to human chromosome 14q23.1. Within the 33-megabase critical genetic interval, we located the SIX1, SIX4, and SIX6 genes, which act within a genetic network of EYA and PAX genes to regulate organogenesis. These genes, therefore, represented excellent candidate genes for BOS3. By direct sequencing of exons, we identified three different SIX1 mutations in four BOR͞BO kindreds, thus identifying SIX1 as a gene causing BOR and BO syndromes. To elucidate how these mutations cause disease, we analyzed the functional role of these SIX1 mutations with respect to proteinprotein and protein-DNA interactions. We demonstrate that all three mutations are crucial for Eya1-Six1 interaction, and the two mutations within the homeodomain region are essential for specific Six1-DNA binding. Identification of SIX1 mutations as causing BOR͞BO offers insights into the molecular basis of otic and renal developmental diseases in humans.

show abstract

“…Six gene products are characterized by the Six domain and Six-type homeodomain, which are required for specific DNA binding activity and function as transcription factors (Kawakami et al, 1996;Spitz et al, 1998;Ohto et al, 1999;Li et al, 2002;Lagutin et al, 2003). At present, six members of the family have been identified in mammals, and all members show a spatiotemporally regulated pattern of expression during embryogenesis, suggesting their involvement in embryonic development (Seo et al, 1999;Kawakami et al, 2000).…”

Section: Introductionmentioning

confidence: 99%

Six1controls patterning of the mouse otic vesicle

et al. 2004

View full text Add to dashboard Cite

A similar gene network was found to control chick myogenesis, in which Six1, Eya2 and Dach2 synergistically regulate the expression of myogenic genes such as myogenin and MyoD (Heanue et Six1 is a member of the Six family homeobox genes, which function as components of the Pax-Six-Eya-Dach gene network to control organ development. Six1 is expressed in otic vesicles, nasal epithelia, branchial arches/pouches, nephrogenic cords, somites and a limited set of ganglia. In this study, we established Six1-deficient mice and found that development of the inner ear, nose, thymus, kidney and skeletal muscle was severely affected. Six1-deficient embryos were devoid of inner ear structures, including cochlea and vestibule, while their endolymphatic sac was enlarged. The inner ear anomaly began at around E10.5 and Six1 was expressed in the ventral region of the otic vesicle in the wild-type embryos at this stage. In the otic vesicle of Six1-deficient embryos, expressions of Otx1, Otx2, Lfng and Fgf3, which were expressed ventrally in the wildtype otic vesicles, were abolished, while the expression domains of Dlx5, Hmx3, Dach1 and Dach2, which were expressed dorsally in the wild-type otic vesicles, expanded ventrally. Our results indicate that Six1 functions as a key regulator of otic vesicle patterning at early embryogenesis and controls the expression domains of downstream otic genes responsible for respective inner ear structures. In addition, cell proliferation was reduced and apoptotic cell death was enhanced in the ventral region of the otic vesicle, suggesting the involvement of Six1 in cell proliferation and survival. In spite of the similarity of otic phenotypes of Six1-and Shh-deficient mice, expressions of Six1 and Shh were mutually independent.

show abstract

Expression of myogenin during embryogenesis is controlled by Six/ sine oculis homeoproteins through a conserved MEF3 binding site

Cited by 207 publications

References 40 publications

cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene

cDNA microarrays detect activation of a myogenic transcription program by the PAX3-FKHR fusion oncogene

SIX1 mutations cause branchio-oto-renal syndrome by disruption of EYA1–SIX1–DNA complexes

Six1controls patterning of the mouse otic vesicle

Contact Info

Product

Resources

About