Expression of claudin-4 and -7 in porcine gingival junctional epithelium

Abstract

Junctional epithelium, a nonkeratinized stratified epithelium, extends apically in apposition to the surface of the enamel to form a seal between the epithelium and the tooth. Desmosomes and gap junctions adhere to the junctional epithelium through cell-cell contact, but no evidence of tight junctions has been found. Recently, tight junction hallmark proteins and tight junction-related structures have been identified in stratified squamous epithelium. The present study examined whether tight junction proteins were expressed in the junctional epithelium. We used immunohistochemical techniques to observe expression of claudin-1, -4, -5, -7, and occludin in porcine gingival junctional epithelium. Claudin-4 exhibited immunoreactivity in the intercellular spaces of all layers of the oral epithelium and the junctional epithelium. Stronger expression was observed in junctional epithelial cells adjacent to the inner and outer basal laminae than in the inner cell layers. Immunohistochemical positivity for claudin-7 was clearly observed in the junctional epithelium, but only a faint positivity was observed in the basal layer of the oral epithelium. No immunohistochemical positivity for claudin-1, -5, or occludin was observed in the junctional epithelium. RT-PCR assay confirmed expression of porcine claudin-4 and -7 mRNAs in the junctional epithelium. These findings indicate that claudin-4 and -7 may play a role in the junctional epithelium even in the absence of tight junctions.

Regulation of defensive function on gingival epithelial cells can prevent periodontal disease

“…Therefore, tight junctions do not appear to contribute to barrier function in the junctional epithelium [11] . Although we reported that claudins exist in the junctional epithelium of rat or porcine gingiva [12] , [13] , their roles in the junctional epithelium have not been elucidated. Furthermore, microarray and immunohistochemical analyses demonstrated that the expression of claudin-1 in the junctional epithelium following a chronic lipopolysaccharide (LPS) challenge was weaker than that in healthy subjects [14] .…”

Tumor Necrosis Factor‐α Increases Claudin‐1, 4, and 7 Expression in Tubular Cells: Role in Permeability Changes

“…SYBR green-based real-time PCR was performed as in (Amoozadeh et al, 2015) to evaluate gene expression of Cldn-1, 2, 4, and 7 using GAPDH as the reference standard. Primer pairs designed against the corresponding pig sequences were as follows: Cldn-1: 5 0 -TTCTGGGAGGTGCCCTACTT-3 0 and R: 5 0 -TGGAT AGGGCCTTGGTGTTG-3 0 (Yu et al, 2014); Cldn-2: 5 0 -GCACTG GCATCACCCAGTGT-3 0 and 5 0 -GATGATACAGGCCAACGA GG-3 (Amoozadeh et al, 2015); Cldn-4: 5 0 -CAACTGCGTGG ATGATGAGA-3'and 5 0 -CCAGGGGATTGTAGAAGTCG-3 0 (Pasternak et al, 2015); Cldn-7: 5 0 -TATGAGTTTGGCCCTGC CATC-3'and 5 0 -CCTTGGCAGAATTGGGCTTAG-3 0 (Saitoh et al, 2009) and GAPDH: 5 0 GCAAAGTGGACATGGTCGCC ATCA-3 0 and 5 0 -AGCTTCCCATTCTCAGCCTTGACT-3 0 (Amoozadeh et al, 2015).…”

Morphological and Functional Analyses of the Tight Junction in the Palatal Epithelium of Mouse

“…In oral epithelia, however the existence of TJs was detected by means of ultrathin sections, but the functional significance was doubtful because the frequency of the TJs was quite low [ 23 , 26 , 27 ]. On the other hand, OCD is a reliable marker protein for TJ [ 12 ] and this was observed in oral mucosae, namely the buccal mucosa in dogs [ 1 ] and the gingiva in humans [ 5 , 15 , 18 ], and pigs [ 24 ]. However, the distribution pattern and barrier ability in oral epithelia are still unclear, and no report is available for TJs in the palatal epithelium.…”

“…In oral mucosae, OCD, and CLD-1, -4 and -7 have been detected in the buccal epithelium, and the outer and inner epithelia of gingiva in some mammalian species [ 1 , 5 , 9 , 15 , 24 ]. However the combinations of CLD expression patterns vary depending on the types of mucosae and species.…”

“…Oral epithelium, which consists of a stratified squamous epithelium, is exposed to severe conditions such as mechanical stimulus during mastication and alien substances. The TJs in the oral mucosa have been demonstrated in the gingiva by electron microscopic observations [ 17 ], and CLD compositions in the gingiva and the buccal mucosa [ 1 , 15 , 24 ]. However, no report is available with regard to TJ associated barrier function of oral epithelia.…”