Expression of Ah receptor (TCDD receptor) during human monocytic differentiation

Hayashio, Shin ichi; Okabe‐Kado, Junko; Honma, Yoshio; Kawajiri, Kaname

doi:10.1093/carcin/16.6.1403

Cited by 64 publications

(32 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The AhR, already known to mediate many immunosuppressive effects of PAHs (5,15), is most likely involved because 1) this receptor and its cofactor ARNT are present in cultured monocytes in agreement with a previous report (37) and are fully functional as assessed by RT-PCR analyses of CYP1A1 expression, 2) among PAHs such as BP, DMBA, MC, and BeP, only the latter, which does not interact with AhR in contrast with the others (38), failed to down-regulate the formation of adherent macrophagic cells, and 3) the AhR antagonist ␣-naphtoflavone counteracted BP action on the macrophagic differentiation pathway. Therefore, through interacting with AhR in monocytic cells, PAHs might activate unidentified factors that hamper macrophage formation or, alternatively, might down-regulate factors required for macrophagic differentiation.…”

Section: Discussionsupporting

confidence: 88%

Polycyclic Aromatic Hydrocarbons Inhibit Differentiation of Human Monocytes into Macrophages

Grevenynghe

Rion

Ferrec

et al. 2003

The Journal of Immunology

143

View full text Add to dashboard Cite

Polycyclic aromatic hydrocarbons (PAHs) such as benzo(a)pyrene (BP) are ubiquitous environmental carcinogenic contaminants exerting deleterious effects toward cells acting in the immune defense such as monocytic cells. To investigate the cellular basis involved, we have examined the consequences of PAH exposure on macrophagic differentiation of human blood monocytes. Treatment by BP markedly inhibited the formation of adherent macrophagic cells deriving from monocytes upon the action of either GM-CSF or M-CSF. Moreover, it reduced expression of macrophagic phenotypic markers such as CD71 and CD64 in GM-CSF-treated monocytic cells, without altering cell viability or inducing an apoptotic process. Exposure to BP also strongly altered functional properties characterizing macrophagic cells such as endocytosis, phagocytosis, LPS-triggered production of TNF-α and stimulation of allogeneic lymphocyte proliferation. Moreover, formation of adherent macrophagic cells was decreased in response to PAHs distinct from BP such as dimethylbenz(a)anthracene and 3-methylcholanthrene, which interact, like BP, with the arylhydrocarbon receptor (AhR) known to mediate many PAH effects. In contrast, benzo(e)pyrene, a PAH not activating AhR, had no effect. In addition, AhR was demonstrated to be present and functional in cultured monocytic cells, and the use of its antagonist α-naphtoflavone counteracted inhibitory effects of BP toward macrophagic differentiation. Overall, these data demonstrate that exposure to PAHs inhibits functional in vitro differentiation of blood monocytes into macrophages, likely through an AhR-dependent mechanism. Such an effect may contribute to the immunotoxicity of these environmental carcinogens owing to the crucial role played by macrophages in the immune defense.

show abstract

Section: Discussionsupporting

confidence: 88%

Polycyclic Aromatic Hydrocarbons Inhibit Differentiation of Human Monocytes into Macrophages

Grevenynghe

Rion

Ferrec

et al. 2003

The Journal of Immunology

143

View full text Add to dashboard Cite

show abstract

“…Primer sequences used in PCR amplification were as follows: AHR3, ATACTGAAGCAGAGCTGT-GC, and AHR4, AAAGCAGGCGTGCATTAGACfor AhR [22]; ANTS, CGGAACAAGATGACAG-CCTAC, and ANTS, ACAGAAAGCCATCTGCT-GCC for Arnt [22]; CB1, TATCCTGATGTGCA GACTCG, and CB2, TCCTTGTTGATGAGGCCA-TC for CYP1B1 [23]; DOK1, ACTCTGTTGCGTCG-CTATGG, and DOK2, CAGCTCTGAGAACATCG-TGC for p62(dok); GAP1, ACATCGCTCAGACA-CCATGG, and GAP2, GTAGTTGAG GTCAAT-GAAGGG for GAPDH [22]. Tissue procurement Tissues of uterine endometrium were obtained from 33 premenopausal women undergoing laparoscopic surgery for benign disorders as summarized in Table 1.…”

Section: Reagentsmentioning

confidence: 99%

Expression of Ah Receptor and Dioxin-Related Genes in Human Uterine Endometrium in Women with or without Endometriosis.

et al. 1999

View full text Add to dashboard Cite

Abstract.2,3,7,8-Tetrachlorodibenzo p-dioxin (TCDD) has been suggested as a possible etiologic factor for endometriosis, a condition in which endometrium-like tissues are present outside the uterus. The prevailing view pertaining to the origin of endometriotic cells is that they are from eutopic endometrial cells which regurgitate through fallopian tubes. In order to get insight into the possible involvement of TCDD in the pathogenesis of endometriosis, we suspected that TCDD may act differently on the endometrium with or without endometriosis. To address this, we examined the presence of messenger RNAs of arylhydrocarbon receptor (AhR), AhR nuclear translocator (Arnt) and two dioxin-responsive genes, cytochrome P-450 1B1 (CYP1B1) and downstream of tyrosine kinases (p62(dok)), in the endometrium of women with or without endometriosis using semi-quantitative reverse transcription-polymerase chain reaction. All the genes were expressed throughout the menstrual cycle. The expression level of p62(dok) was higher in the proliferative phase than in the secretory phase. In contrast, the expression levels of AhR, Arnt and CYP 1 B 1 seemed to be constant during the cycle. In terms of the comparison between non-endometriosis and endometriosis group, the mRNA levels of AhR, Arnt, CYP 1 B 1 and p62(dok) were essentially similar. Interestingly, AhR mRNA level was significantly lower in smokers than in non-smokers.Based on the regression analysis, significant linear and positive correlations were observed between AhR and Arnt mRNA levels, and between Arnt and p62(dok) mRNA levels. In summary, expression of AhR and dioxin-related genes in the endometrium did not differ in women with or without endometriosis.

show abstract

“…Chemistry DIM (1), its derivatives (4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17), and isomers of DIM [2,2Ј-DIM (22) and 2,3Ј-DIM (25)] were synthesized using the methods reported by Nagarajan and Perumal 11) and usual organic synthetic methods as shown in Charts 1 and 2. Briefly, DIM (1) and its derivatives (4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17) were obtained by the reaction of indole or methylindole with various aldehydes or ketones (Chart 1).…”

Section: Resultsmentioning

confidence: 99%

“…Briefly, DIM (1) and its derivatives (4)(5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17) were obtained by the reaction of indole or methylindole with various aldehydes or ketones (Chart 1). Bis(1-benzenesulfonyl-1H-indol-2-yl)methanol (20) and (1-benzenesulfonyl-1H-indol-2-yl)(1-benzenesulfonyl-1H-indol-3-yl)methanol (24) was obtained by the reaction of 2-(19) or 3-formyl-1-benzenesulfonyl-1H-indole (23) with 1-benzenesulfonyl-1H-indole (18), followed by reduction and desulfonylation to give 2,2Ј-DIM (22) or 2,3Ј-DIM (25) (Chart 2).…”

Section: Resultsmentioning

confidence: 99%

“…Dialkyl substitution at the methylene carbon of DIM [diMeDIM (13), diEtDIM (14), diPrDIM (15)] also increased the activity, with the dimethyl derivative, diMeDIM (13), seemed to be the most potent (168%). The cycloalkyl derivatives, c5DIM (16) and c6DIM (17), also showed rather potent enhancing activity, with the former (16) possessing the higher activity (188%) than the latter (17: 140%).…”

Section: Effects On Hl-60 Cell Differentiationmentioning

confidence: 99%

See 1 more Smart Citation

Enhancement of Chemically-Induced HL-60 Cell Differentiation by 3,3'-Diindolylmethane Derivatives

et al. 2009

View full text Add to dashboard Cite

3,3Ј-Diindolylmethane (DIM, 1) is a major metabolite (spontaneously formed product in intragastric acid condition) of indole-3-carbinol (I3C, 2) which is a phytochemical expressed in brassica vegetables, including broccoli, brussels sprouts, kales and the cabbages, and has been thought to be associated with the anticancer/cancer chemopreventive activities of vegetable consumption.1) DIM (1) controls proliferation of various tumor cells, including cells of breast cancer, prostate cancer, ovary cancer, lung cancer and pancreatic cancer, by inducing G 1 /S arrest of the cell cycle and apoptosis.2) In addition, DIM (1) modulates metabolism of estrogen and testosterone, 3,4) which act as indigenous tumor promoters for several hormone-dependent cancers. DIM (1) is also reported to be a weak agonist for the arylhydrocarbon receptor (AhR) and blocks the effects of estrogens via inhibition of AhR-estrogen receptor cross talk.5) In addition, DIM (1) possesses other various activities, including immunomodulatory effect.6) All the experimental studies suggest that DIM (1) has incredible potential both for prevention and for treatment of cancer.Although the molecular basis of cancer chemopreventive and cancer chemotherapic effects of DIM (1) is unclear, effects of DIM (1) on cell differentiation would be one of candidate mechanisms underlying the biological activities elicited by DIM (1). In fact, Kim et al. recently reported that indirubin, another AhR agonist with a structure related to that of DIM (1), and its derivatives show enhancing effect on 1,25-dihydroxyvitamin D 3 (1,25-VD 3 )-and all-trans retinoic acid (ATRA)-induced cell differentiation of HL-60 leukemia cells. 7)Under such circumstances, we investigated the enhancing effect on chemically-induced HL-60 cell differentiation of DIM (1) and its derivatives in combination with various cell differentiation inducers, including ATRA, tamibarotene (Am80, 3), 1,25-VD 3 , 12-O-tetradecanoyl phorbol-13-acetate (TPA) and dimethyl sulfoxide (DMSO). All of these chemicals are known to induce terminal differentiation in leukemic cell lines, including HL-60 and U937 cells. ATRA and Am80 are therapeutic agents for acute promyelocytic leukemia (APL) and induce differentiation of HL-60 cells to mature granulocytes.8) On the other hand, 1,25-VD 3 and TPA have been established to induce differentiation of HL-60 cells to mature monocytes. 9) DMSO is another typical cell differentiation inducer. 10) Results and DiscussionChemistry DIM (1), its derivatives (4-17), and isomers of DIM [2,2Ј-DIM (22) and 2,3Ј-DIM (25) Bunkyo-ku, Tokyo 113-0032, Japan. Received January 8, 2009; accepted February 19, 2009; published online February 24, 2009 3,3-Diindolylmethane (DIM, 1) and its derivatives have been prepared, and their enhancing effects on chemically-induced HL-60 cell differentiation were analyzed. Among the prepared compounds, IndDIM (12) showed the most potent enhancing effect on HL-60 cell differentiation induced by chemicals, including retinoids, 1,25-dihydroxyvitamin D 3 , 12-O-...

show abstract

Expression of Ah receptor (TCDD receptor) during human monocytic differentiation

Cited by 64 publications

References 0 publications

Polycyclic Aromatic Hydrocarbons Inhibit Differentiation of Human Monocytes into Macrophages

Polycyclic Aromatic Hydrocarbons Inhibit Differentiation of Human Monocytes into Macrophages

Expression of Ah Receptor and Dioxin-Related Genes in Human Uterine Endometrium in Women with or without Endometriosis.

Enhancement of Chemically-Induced HL-60 Cell Differentiation by 3,3'-Diindolylmethane Derivatives

Contact Info

Product

Resources

About