Expression, inducer spectrum, domain structure, and function of MopR, the regulator of phenol degradation in Acinetobacter calcoaceticus NCIB8250

Abstract

Degradation of phenol by

Aromatic ligand binding and intramolecular signalling of the phenol‐responsive σ54‐dependent regulator DmpR

“…3). In agreement with these data, in vivo inhibition of derivatives of the cognate regulator by overexpression of the A-domains of XylR (Perez-Martin and de Lorenzo, 1995a) and MopR (Schirmer et al, 1997) in trans have recently been shown to be unaffected by the addition of effectors. Hence, for DmpR and, in all probability, for XylR and MopR, effector nonresponsiveness of the physically uncoupled A-domain is an intrinsic property.…”

“…Similarly, the DNA binding properties of 70 and related sigma factors are also under repression control (Dombroski et al, 1993). DmpR (Shingler and Pavel, 1995) belongs to a mechanistic subgroup of 54 -dependent regulators, which includes XylR (Delgado et al, 1995;Ferná ndez et al, 1995), MopR (Schirmer et al, 1997), DctD (Gu et al, 1994), FhlA (Korsa and Bö ck, 1997) and RocR (Gardan et al, 1997), in which deletion and/or mutation analysis has implicated intramolecular repression as a common control mechanism (for review, see Shingler, 1996).…”

“…The activities of another subgroup of the family, including NifA and some NifA-like proteins, are controlled by signal responsive protein-protein interactions. DmpR, however, belongs to the rapidly growing mechanistic subgroup that directly senses and responds to small effector molecules (Shingler and Moore, 1994;Shingler and Pavel, 1995) and includes the aromatic responsive regulators XylR (Abril et al, 1989;Delgado and Ramos, 1994), PhhR (Ng et al, 1995), TbuT (Byrne and Olsen, 1996), MopR (Schirmer et al, 1997), the formate-responsive FhlA (Hopper and Bö ck, 1995) and the ornithine/citrulline-responsive RocR (Gardan et al, 1997).…”

A novel mode of control of Mycoplasma pneumoniae HPr kinase/phosphatase activity reflects its parasitic lifestyle

“…The primers used for amplification of the ptsH gene were KS 34 (5h-AAAGTCGACATGAAGAAGATTCAA GTAGTCGTTAAAGAC-3h) and KS 35 (5h-AAAAAGCTTT TAAATAACTTGGTGTTTTTCTAAAACTGC-3h). The PCR products were digested with SalI and HindIII, and the resulting fragments were cloned into the expression vector pWH844 (Schirmer et al, 1997) cut with the same enzymes. The resulting plasmids were pGP204 (for hprK) and pGP217 (for ptsH).…”

Specific binding of the regulatory protein ExpG to promoter regions of the galactoglucan biosynthesis gene cluster of Sinorhizobium meliloti - a combined molecular biology and force spectroscopy investigation

“…Plasmid pHisG4032 was constructed by insertion of a 573 bp BamHI-HindIII fragment carrying expG of S. meliloti 2011 (Casse et al, 1979) into vector pWH844 (Schirmer et al, 1997). This Fragment was amplified by PCR with primer HisG5 (5 0 -AAAAGGATCCAT GAACCACAGGATACTCTATCCGT, BamHI restriction site is underlined) and HisG3 (5 0 -AAAA AAGCTTCATGTTACCGCCCTTGCTCG, HindIII restriction site is underlined) from pARIIa .…”