Expression cloning of the TGF-β type II receptor, a functional transmembrane serine/threonine kinase

Lin, Herbert Y.; Wang, Xiaofan; Ng-Eaton, Elinor; Weinberg, Robert A.; Lodish, Harvey F.

doi:10.1016/0092-8674(92)90152-3

Cited by 1,008 publications

(532 citation statements)

References 54 publications

Supporting

Mentioning

516

Contrasting

Unclassified

Order By: Relevance

“…Western blot analysis con®rmed that the transgene derived RNA which encodes a 286 aa polypeptide gives rise to a protein of 44 kDa. This compares well to the mass of the amino acids of the truncated receptor plus glycosylation to the same extent as it had been described for the wild type receptor (Lin et al, 1992). Correct glycosylation seems to be important for the functionality of the type II receptor (Fafeur et al, 1993).…”

Section: Discussionsupporting

confidence: 81%

“…The expression casssette was excised by KpnI digestion, gel puri®ed, and used for pronuclear microinjection of fertilized eggs of strain FVB/N essentially as described (Hogan et al, 1986). O spring was biopsied at ears or tails and analysed by PCR using a bovine keratin 5 (ATGAAGACAGCGTTTGCACCC) and a human type II TGF-b receptor speci®c oligonucleotide (TGCACTCAT-CAGAGCTACAGG) or Southern blotting using a bovine keratin 5 speci®c probe (Jorcano et al, 1984b;Lin et al, 1992).…”

Section: Generation Of Transgenic Micementioning

confidence: 99%

“…Filters were processed at high stringency as described (Church and Gilbert, 1984). As a hybridization probe the cDNA of the human truncated type II TGF-b receptor or exon 1 of the mouse type II TGF-b receptor were used (Lin et al, 1992;Oshima et al, 1996). Both probes were approximately 700 bp and labeled with similar speci®c activity.…”

Section: Northern Blot Analysismentioning

confidence: 99%

See 2 more Smart Citations

Expression of a dominant negative type II TGF-β receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma development

et al. 1998

View full text Add to dashboard Cite

The role of Transforming growth factor beta (TGF-b) in carcinogenesis is complex. There are reports on both tumor inhibition and tumor promotion by TGF-b. To elucidate the complex role of TGF-b in epithelial carcinogenesis, we generated transgenic mice overexpressing a dominant negative type II TGF-b receptor in the basal cell compartment and in follicular cells of the skin. Despite the reduced responsiveness of transgenic keratinocytes to TGF-b, both proliferation and di erentiation were normal in non-irritated epidermis of these transgenic mice. Thus, interruption of signaling of all three isoforms of TGF-b in basal and follicular cells does not disturb tissue homeostasis. However, during tumor promotion transgenic mice showed an elevated level of proliferation in the epidermis. This hyperproliferation correlated with a very early onset of carcinoma development and a malignant conversion frequency of 30% from benign papillomas to carcinomas. By comparison, the conversion frequency in wild-type mice of this strain has previously been reported as 5.5%. Even without induction of hyperproliferation by tumor promoters, transgenic mice developed far more carcinomas as controls when treated with a carcinogen. This result indicates that there is a synergistic e ect between loss of TGF-b responsiveness and mutations caused by initiation with a carcinogen leading to an endogeneous tumor promotion in initiated cells only.

show abstract

Section: Discussionsupporting

confidence: 81%

Section: Generation Of Transgenic Micementioning

confidence: 99%

Section: Northern Blot Analysismentioning

confidence: 99%

See 1 more Smart Citation

Expression of a dominant negative type II TGF-β receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma development

et al. 1998

View full text Add to dashboard Cite

show abstract

“…Two mg of poly(A) RNA was electrophoresed on a 1.0% agarose gel containing 0.66 M formaldehyde, transferred to a Duralon-UV membrane, and cross-linked with a UV Stratalinker (Stratagene). Blots were hybridized with cDNA probes for human TGF-b type I and II receptors (FranzeÂ n et al, 1993;Lin et al, 1992).…”

Section: Northern Blot Analysismentioning

confidence: 99%

Transcriptional repression of the transforming growth factor-β type I receptor gene by DNA methylation results in the development of TGF-β resistance in human gastric cancer

et al. 1999

View full text Add to dashboard Cite

The transforming growth factor-b (TGF-b) signaling pathway subserves an essential tumor suppressor function in various cell types. A heteromeric complex composed of TGF-b type I (RI) and type II (RII) receptors is required for TGF-b signaling. We have identi®ed a subset of human gastric cancer cell lines which are insensitive to TGF-b and which express a low level of TGF-b type I receptor mRNA relative to a gastric cancer cell line which is highly responsive to TGF-b. Using these cells, we show that hypermethylation of a CpG island in the 5' region of the TGF-b RI gene provides another potentially important mechanism of escape from negative growth control by TGF-b. This hypermethylation was found in four of ®ve human gastric cancer cell lines and ®ve out of 40 (12.5%) primary tumors examined. In human gastric cancer cell lines, treatment with the demethylating agent, 5-aza-2'-deoxycytidine, resulted in increased expression of the TGF-b RI gene, but not the RII gene. Transient transfection of an RI expression vector into the TGF-b resistant SNU-601 cell line restores TGF-b responsiveness. These ®ndings suggest that one of the mechanisms of escape from autocrine or paracrine growth control by TGF-b during carcinogenesis could involve aberrant methylation of CpG islands in the 5' region of the TGF-b RI gene.

show abstract

“…While RI and RII are glycoproteins of 53 and 75 kDa, respectively, RIII is a 280 ± 330 kDa proteoglycan (Yingling et al, 1995). RI and RII are serine/ threonine kinases which form an active heterooligomeric complex and are the key players in the TGF-b mediated signaling cascade (Franzen et al, 1993;Lin et al, 1992;Wrana et al, 1992Wrana et al, , 1994. Recent studies indicate that, following TGF-b binding and subsequent activation of RI by RII, RI phosphorylates Smad2 and/or Smad3, which can then associate with Smad4 and translocate to the nucleus where binding to the target DNA or other DNA binding proteins occurs.…”

Section: Introductionmentioning

confidence: 99%

Repression of transforming growth factor-β receptor type I promoter expression by Sp1 deficiency

Periyasamy

Ammanamanchi²,

Tillekeratne

et al. 2000

Oncogene

View full text Add to dashboard Cite

In this report, we describe the mechanism of TGF-b receptor type I (RI) repression in the GEO human colon carcinoma cells. Treatment of GEO cells with the DNA methyltransferase inhibitor, 5 azacytidine induced RI expression and restored TGF-b response. A stably transfected RI promoter-reporter construct (RI-Luc) expressed higher activity in the 5 aza C treated GEO cells, suggesting the activation of a transactivator for RI transcription. Gel shift analysis indicated enhanced binding of proteins from the 5 aza C treated nuclear extracts to radiolabeled Sp1 oligonucleotides speci®cally contained in the RI promoter. Protein stability studies after cyclohexamide treatment suggested an increase in the Sp1 protein stability from the 5 aza C treated GEO cells. Further, transfection of Sp1 cDNA into untreated GEO control cells increased RI promoter activity and thus induced RI expression. 5 aza C mediated Sp1 expression in Sp1 de®cient GEO colon and MCF-7 breast cancer cells also enhanced the activity of several other Sp1 dependent promoters such as TGFb receptor type II (RII), Cyclin A and p21/waf1/cip1. These results indicate that restoration of Sp1 in several di erent types of Sp1 de®cient cells leads to enhanced activation of a wide range of Sp1 dependent promoters. Oncogene (2000) 19, 4660 ± 4667.

show abstract

Expression cloning of the TGF-β type II receptor, a functional transmembrane serine/threonine kinase

Cited by 1,008 publications

References 54 publications

Expression of a dominant negative type II TGF-β receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma development

Expression of a dominant negative type II TGF-β receptor in mouse skin results in an increase in carcinoma incidence and an acceleration of carcinoma development

Transcriptional repression of the transforming growth factor-β type I receptor gene by DNA methylation results in the development of TGF-β resistance in human gastric cancer

Repression of transforming growth factor-β receptor type I promoter expression by Sp1 deficiency

Contact Info

Product

Resources

About