Expression and purification of a trivalent pertussis toxin–diphtheria toxin–tetanus toxin fusion protein in Escherichia coli

Aminian, Mahdi; Sivam, Sheila; Lee, Chiang W.; Halperin, Scott A.; Lee, Song F.

doi:10.1016/j.pep.2006.07.017

Cited by 10 publications

(10 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…It was observed that only low concentration of soluble hIGF-1 fusion protein was expressed in E. coli BL21 (DE3), which may due to the rare codons encoding for seven amino acid residues (4 AGG, 2 CCC and 1 CUA) in the mature human IGF-1, resulting in the dramatic reduction of target protein expression [20]. By supplying tRNAs for AGG, AGA, AUA, CUA, CCC, GGA codons on a compatible chloramphenicol-resistant plasmid, E. coli Rosetta (DE3) and E. coli Rosetta-gami (DE3) harboring such plasmid have the ability to alleviate rare-codon usage bias of mature human IGF-1 absolutely [21,22], so the translation of the target protein impaired by the bias could be recovered. The results had revealed that the productivity of hIGF-1 fusion protein was increased dramatically when E. coli Rosetta-gami (DE3) was applied as the host.…”

Section: Discussionmentioning

confidence: 99%

High-level soluble expression of hIGF-1 fusion protein in recombinant Escherichia coli

Zhang¹,

Wei²,

Fan³

et al. 2010

Process Biochemistry

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

High-level soluble expression of hIGF-1 fusion protein in recombinant Escherichia coli

Zhang¹,

Wei²,

Fan³

et al. 2010

Process Biochemistry

View full text Add to dashboard Cite

“…The gene encoding an enzymatically inactive and nontoxic form of the diphtheria toxin (toxoid, toxC ) from Corynebacterium diphtheriae was amplified from plasmid pPDT1 72 with oligonucleotides CS-378 (5′- ATATATATCCATGGCTGCTGATGATGTTGTTGATTC-3′) and CS-379 (5′- ATATACTCGAGTCGCCTGACACGATTTCCTGCACAGG3′) to introduce NcoI and XhoI sites, respectively. The obtained NcoI-XhoI digested PCR product was inserted into plasmid pET22b cut with the same enzymes translationally fusing the gene to the plasmid-derived pelB secretion sequence for the transport of the product into the periplasmic space.…”

Section: Methodsmentioning

confidence: 99%

Engineering the Campylobacter jejuni N-glycan to create an effective chicken vaccine

Nothaft

Davis²,

Lock³

et al. 2016

Sci Rep

View full text Add to dashboard Cite

Campylobacter jejuni is a predominant cause of human gastroenteritis worldwide. Source-attribution studies indicate that chickens are the main reservoir for infection, thus elimination of C. jejuni from poultry would significantly reduce the burden of human disease. We constructed glycoconjugate vaccines combining the conserved C. jejuni N-glycan with a protein carrier, GlycoTag, or fused to the Escherichia coli lipopolysaccharide-core. Vaccination of chickens with the protein-based or E. coli-displayed glycoconjugate showed up to 10-log reduction in C. jejuni colonization and induced N-glycan-specific IgY responses. Moreover, the live E. coli vaccine was cleared prior to C. jejuni challenge and no selection for resistant campylobacter variants was observed. Analyses of the chicken gut communities revealed that the live vaccine did not alter the composition or complexity of the microbiome, thus representing an effective and low-cost strategy to reduce C. jejuni in chickens and its subsequent entry into the food chain.

show abstract

“…The 1509 bp putative EndoG ORF was amplified by RT-PCR from total RNA of L. donovani, cloned in pGEX-4T vector and transformed into Escherichia coli, Rosetta strain. 19 Recombinant LdEndoG was either eluted as GST-LdEndoG using reduced glutathione or as LdEndoG using FactorX by cleaving GST tag. Figure 4a shows that GST-LdEndoG and LdEndoG were purified to essential homogeneity.…”

mentioning

confidence: 99%

The caspase-independent algorithm of programmed cell death in Leishmania induced by baicalein: the role of LdEndoG, LdFEN-1 and LdTatD as a DNA ‘degradesome’

et al. 2008

View full text Add to dashboard Cite

In the post-genomic perspective, the quest of programmed cell death (PCD) mechanisms in kinetoplastid parasites lies in the identification and characterization of cell death executer proteins. Here, we show that baicalein (BLN), a potent topoisomerase IB inhibitor, generates an oxidative stress in the parasites leading to altered physiological and morphological parameters, which are characteristic of PCD. For the first time we elucidate that, caspase-independent activation of a novel effector molecule, endonuclease G (LdEndoG), mediates BLN-induced cell death. Functional characterization of LdEndoG identifies Flap endonuclease-1 (LdFEN-1) and LdTatD-like nuclease as other effector molecules. BLN treatment translocates LdEndoG from mitochondria to nucleus, where it forms separate complexes with LdFEN-1 and LdTatD to constitute a DNA 'degradesome' unique to these parasites. Conditional antisense knockdown of LdEndoG provides protection against PCD. This knowledge paves the path toward a better understanding of the PCD pathway in simpler systems, which could be exploited in antileishmanial chemotherapy.

show abstract

Expression and purification of a trivalent pertussis toxin–diphtheria toxin–tetanus toxin fusion protein in Escherichia coli

Cited by 10 publications

References 26 publications

High-level soluble expression of hIGF-1 fusion protein in recombinant Escherichia coli

High-level soluble expression of hIGF-1 fusion protein in recombinant Escherichia coli

Engineering the Campylobacter jejuni N-glycan to create an effective chicken vaccine

The caspase-independent algorithm of programmed cell death in Leishmania induced by baicalein: the role of LdEndoG, LdFEN-1 and LdTatD as a DNA ‘degradesome’

Contact Info

Product

Resources

About