Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line

Abstract

Many heavy metals, including nickel (Ni), cadmium (Cd), and chromium (Cr) are toxic industrial chemicals with an exposure risk in both occupational and environmental settings that may cause harmful outcomes. While these substances are known to produce adverse health effects leading to disease or health problems, the detailed mechanisms remain unclear. To elucidate the processes involved in the toxicity of nickel, cadmium, and chromium at the molecular level and to perform a comparative analysis, H4-II-E-C3 rat liver-derived cell lines were treated with soluble salts of each metal using concentrations derived from viability assays, and gene expression patterns were determined with DNA microarrays. We identified both common and unique biological responses to exposure to the three metals. Nickel, cadmium, chromium all induced oxidative stress with both similar and unique genes and pathways responding to this stress. Although all three metals are known to be genotoxic, evidence for DNA damage in our study only exists in response to chromium. Nickel induced a hypoxic response as well as inducing genes involved in chromatin structure, perhaps by replacing iron in key proteins. Cadmium distinctly perturbed genes related to endoplasmic reticulum stress and invoked the unfolded protein response leading to apoptosis. With these studies, we have completed the first gene expression comparative analysis of nickel, cadmium, and chromium in H4-II-E-C3 cells.

Molecular basis of carcinogenicity of tungsten alloy particles

“…WNF 97-2-1 dissolves more slowly, at least from pellets (Schuster et al, 2012), produces only small quantities of reactive oxygen species compared to WNC 91-6-3, (Harris et al, 2011) and results in relatively few gene expression changes in HSkMC cells. As nickel can also alter expression of many of the genes affected by cobalt, for example HMOX1 and VEGFA (Permenter et al, 2011;Steinbrech et al, 2000), alloy formulations that dissolve to form higher local concentrations of nickel may also have greater effects, though to test this would require analysis of a range of different alloy formulations. Overall the results from the HSkMC cells agree with those from L6-C11 cells.…”

Role of DNA Methylation in Cell Cycle Arrest Induced by Cr (VI) in Two Cell Lines

“…The primer sequences were as follows: p16 5′-GGCACCAGAGGCAGTAACCA-3′ (forward) and 5′-CCTACGCATGCCTGCTTCTACA-3′, (reverse), CDK6 5′-GTGACCAGCAGCGGACAAATAA-3′ (forward) and 5′-AGCAAGACTTCGGGTGCTCTGTA-3′ (reverse), CDK4 5′-TTCTGCAGTCCACATATGCAACA-3′ (forward) and 5′- GGTCGGCTTCAGAGTTTCCAC -3′ (reverse), and GAPDH 5′- GAAGGTGAAGGTCGGAGTC -3′ (forward) and 5′- GAAGATGGTGATGGGATTTC -3′ (reverse). Relative fold change was determined using the comparative C t method using GAPDH as endogenous control [16].…”

Oral exposure of mice to cadmium (II), chromium (VI) and their mixture induce oxidative- and endoplasmic reticulum-stress mediated apoptosis in the livers

“…Oxidative stress and ER stress have become the important subjects in mammalian toxicology, and some non-essential heavy metals may be directly involved in these processes (Guo et al, 2009;Cao et al, 2013). Supporting this idea, some published data suggested that the exposure to metals could generate reactive oxygen species (ROS), causing the oxidative stress or ER stress in different tested models (Permenter et al 2011;Wang et al, 2013;Xu et al, 2013).…”