Exposure to MIV-150 from a High-Dose Intravaginal Ring Results in Limited Emergence of Drug Resistance Mutations in SHIV-RT Infected Rhesus Macaques

Abstract

When microbicides used for HIV prevention contain antiretroviral drugs, there is concern for the potential emergence of drug-resistant HIV following use in infected individuals who are either unaware of their HIV infection status or who are aware but still choose to use the microbicide. Resistant virus could ultimately impact their responsiveness to treatment and/or result in subsequent transmission of drug-resistant virus. We tested whether drug resistance mutations (DRMs) would emerge in macaques infected with simian immunodeficiency virus expressing HIV reverse transcriptase (SHIV-RT) after sustained exposure to the potent non-nucleoside reverse transcriptase inhibitor (NNRTI) MIV-150 delivered via an intravaginal ring (IVR). We first treated 4 SHIV-RT-infected animals with daily intramuscular injections of MIV-150 over two 21 day (d) intervals separated by a 7 d drug hiatus. In all 4 animals, NNRTI DRMs (single and combinations) were detected within 14 d and expanded in proportion and diversity with time. Knowing that we could detect in vivo emergence of NNRTI DRMs in response to MIV-150, we then tested whether a high-dose MIV-150 IVR (loaded with >10 times the amount being used in a combination microbicide IVR in development) would select for resistance in 6 infected animals, modeling use of this prevention method by an HIV-infected woman. We previously demonstrated that this MIV-150 IVR provides significant protection against vaginal SHIV-RT challenge. Wearing the MIV-150 IVR for 56 d led to only 2 single DRMs in 2 of 6 animals (430 RT sequences analyzed total, 0.46%) from plasma and lymph nodes despite MIV-150 persisting in the plasma, vaginal fluids, and genital tissues. Only wild type virus sequences were detected in the genital tissues. These findings indicate a low probability for the emergence of DRMs after topical MIV-150 exposure and support the advancement of MIV-150-containing microbicides.

Low Frequency of Drug-Resistant Variants Selected by Long-Acting Rilpivirine in Macaques Infected with Simian Immunodeficiency Virus Containing HIV-1 Reverse Transcriptase

“…Similarly, in a macaque study investigating sustained release of the novel NNRTI MIV-150 from intravaginal rings (IVR) in RT-SHIV-infected rhesus macaques, DRMs were not detected by clonal sequencing of plasma virus after 42 days in 5/6 animals using the IVR; however, DRM selection did occur when animals were treated systemically with MIV-150 (39). One IVR-treated animal had a single plasma clone containing Y181I, while all other clones were WT.…”

“…SIV is not susceptible to NNRTIs due to sequence differences within the RT coding region, but NNRTI sensitivity is established by swapping the SIV and HIV-1 RT coding regions (31,32). RT-SHIV macaque models have been used to study HIV-1 ART, drug resistance, PrEP, and persistence (30,(32)(33)(34)(35)(36)(37)(38)(39)(40)(41)(42)(43)(44)(45)(46)(47)(48). In this study, we treated RT-SHIV-infected macaques with RPV LA and measured plasma viremia, drug concentrations, and drug-resistant isolates over 35 weeks.…”

In Vitro Exposure to PC-1005 and Cervicovaginal Lavage Fluid from Women Vaginally Administered PC-1005 Inhibits HIV-1 and HSV-2 Infection in Human Cervical Mucosa

“…RNA was extracted from an aliquot of HIV-1 BaL with the QIAamp UltraSens virus RNA kit (Qiagen, Valencia, CA) and reverse transcribed using SuperScript III First-Strand Supermix and random hexamer primer (Invitrogen, Carlsbad, CA) as previously described (29). PCR amplification was carried out to amplify the RT-RNase H region of the pol gene with primers Pol Fwd (5= AGAGCCAACAGCCCCACCA 3=) and Pol Rev (5= CACCTGCCATCTGTTTTCCA 3=).…”

In Vitro Cross-Resistance Profiles of Rilpivirine, Dapivirine, and MIV-150, Nonnucleoside Reverse Transcriptase Inhibitor Microbicides in Clinical Development for the Prevention of HIV-1 Infection

“…1). To our knowledge, this is the first study to define in detail the crossresistance profile for MIV-150, although one prior study identified different combinations of E138K, Y181I, Y181C, K103N, L100I, or K101E in simian immunodeficiency viruses expressing HIV reverse transcriptase (SHIV-RT viruses) exposed to MIV-150 in rhesus macaques, although no phenotypic data were provided (19). Additionally, prior studies have reported on the resistance profiles of the MIV-150 analogs, namely, MIV-160 and MIV-170 (16,17).…”