Exploring the potential of phosphotriazole 5′ mRNA cap analogues as efficient translation initiators

Walczak, Sylwia; Sikorski, Pawel J.; Kasprzyk, Renata; Kowalska, Joanna; Jemielity, Jacek

doi:10.1039/c8ob01720d

Cited by 13 publications

(17 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…To remove in vitro transcription by-products of unintended size RNA samples were gel-purified using PAA elution buffer (0.3 M sodium acetate, 1 mM EDTA, 0.05% Triton X-100), precipitated with isopropanol and dissolved in water. In order to obtain capped fraction of in vitro transcribed short RNAs, transcripts were treated with 5’-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs) as described previously (33). Finally, to generate homogenous 3’-ends in those short RNAs, the transcripts (1 µM) were incubated with 1 µM DNAzyme 10-23 (TGATCGGCTAGGCTAGCTACAACGAGGCTGGCCGC) in 50 mM MgCl 2 and 50 mM Tris-HCl pH 8.0 for 1 h at 37 °C (32), which allowed to produce 3’-homogenous 25-nt RNAs.…”

Section: Methodsmentioning

confidence: 99%

“…Quality of transcripts was checked on native 1.2% 1xTBE agarose gel, whereas concentration was determined spectrophotometrically. To remove uncapped RNA, transcripts were treated with 5’-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs) as previously described (33). Finally, to deplete dsRNA by-products of in vitro transcription, mRNAs were purified on Agilent Technologies Series 1200 HPLC using RNASep™ Prep – RNA Purification Column (ADS Biotec) at 55 °C as described in (35).…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5’ cap modulates protein expression in living cells

Sikorski

Warmiński

Kubacka

et al. 2019

Preprint

Self Cite

View full text Add to dashboard Cite

7-Methylguanosine 5'-cap on mRNA is necessary for efficient protein expression in vitro and in vivo.Recent studies revealed structural diversity of endogenous mRNA caps, which carry different 5'terminal nucleotides and additional methylations (2'-O-methylation and m 6 A). Currently available 5'capping methods do not address this diversity. We report trinucleotide 5'-cap analogs (m 7 GpppN (m) pG), which are utilized by RNA polymerase T7 to initiate transcription from templates carrying Φ 6.5 promoter and enable production of mRNAs differing in the identity of the first transcribed nucleotide (N = A, m 6 A, G, C, U) and its methylation status (± 2'-O-methylation). HPLCpurified mRNAs carrying these 5' caps were used to study protein expression in three mammalian cell lines (3T3-L1, HeLa, and JAWS II). In all cases the highest expression was achieved for mRNAs carrying 5'-terminal A and m 6 A, whereas the lowest was observed for G and G m . The 2'-O-methylation of the first transcribed nucleotide (cap 1) significantly increased expression compared to cap 0 only in JAWS II dendritic cells. Further experiments indicated that the mRNA expression characteristic does not correlate with affinity for translation initiation factor 4E or in vitro susceptibility to decapping, but instead depends on mRNA purity and the immune state of the cells.by the attack of the 3'-OH of the first transcribed nucleotide defined by the promoter sequence on the α -phosphate of the upcoming NTP, to yield 5'-triphosphate RNA. The first transcribed nucleotide is usually a purine nucleotide; the most common is the use of T7 polymerase and Φ 6.5 promoter, which imposes the initiation with GTP. If an m 7 GpppG-derived cap analog is added to the transcription mixture, the polymerase can initiate the transcription not only from GTP but also by the attack of the 3'-OH from cap analog's guanosine, to produce 5' capped RNA. To increase the number of initiation events from the cap analog (capping efficiency), the ratio of cap to GTP is usually maintained at a high level (from 4:1 up to 10:1). However, even under optimized conditions the capping efficiencies rarely exceed 80%, which means that more than 20% of IVT RNA remains uncapped, and requires additional enzymatic steps to be removed. The standard IVT approach for the synthesis of 5' capped RNAs has also other limitations. First, it has been found that in the case of m 7 GpppG, the polymerase can also initiate transcription from the 3'-OH of m 7 G yielding reversely capped RNA (Gpppm 7 G-RNA). This issue was remedied by the development of so called anti-reverse cap analogs (ARCAs) having chemically modified 3'-O or 2'-O positions of m 7 G (m 2 7,3'-OGpppG is a commercially available analog most commonly used for this purpose) (24,25). However, the chemical structure of ARCA-cappedRNAs is slightly different from the native RNAs, which may affect biological outcomes. Moreover, to ensure high transcription yield the promoter sequence requires a purine as the first transcribed nucleotide. Therefore, capp...

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5’ cap modulates protein expression in living cells

Sikorski

Warmiński

Kubacka

et al. 2019

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…Walczak and co‐workers reported the chemical synthesis of several phosphotriazole cap analogs in order to study its biochemical properties of binding affinity for eIF4E, susceptibility to hDcp2‐catalyzed decapping and translational efficiency. [38] The copper(I)‐catalyzed azide‐alkyne cycloaddition (CuAAC) reaction of phosphonate derivatives of 7,2′‐ O ‐dimethyl gunaosine 74 with 5′‐[P2‐N‐(2‐azidoethyl)diphosphate 75 a or 5′‐[P−O‐(2‐azidoethyl)phosphate 75 b,c in the presence of copper sulphate and sodium ascorbate under aqueous conditions afforded the corresponding dinucleotide cap analog containing a triazole moiety within the phosphate chain 76 (Scheme 9 ). Similarly, the CuAAC reaction of phosphonate derivative of guanosine 77 with 5′‐azido‐5′‐deoxy‐7methylguanosine ( 78 ) furnished the corresponding dinucleotide cap analog containing a triazole moiety directly attached to m 7 G 7 9 (Scheme 10 ).…”

Section: Chemical Synthesis Of Cap Analogsmentioning

confidence: 99%

Recent Advances in Modified Cap Analogs: Synthesis, Biochemical Properties, and mRNA Based Vaccines

Shanmugasundaram

Senthilvelan

Kore

2022

The Chemical Record

View full text Add to dashboard Cite

The recent FDA approval of the mRNA vaccine for severe acute respiratory syndrome coronavirus (SARS‐CoV‐2) emphasizes the importance of mRNA as a powerful tool for therapeutic applications. The chemically modified mRNA cap analogs contain a unique cap structure, m 7 G[5′]ppp[5′]N (where N=G, A, C or U), present at the 5′‐end of many eukaryotic cellular and viral RNAs and several non‐coding RNAs. The chemical modifications on cap analog influence orientation's nature, translational efficiency, nuclear stability, and binding affinity. The recent invention of a trinucleotide cap analog provides groundbreaking research in the area of mRNA analogs. Notably, trinucleotide cap analogs outweigh dinucleotide cap analogs in terms of capping efficiency and translational properties. This review focuses on the recent development in the synthesis of various dinucleotide cap analogs such as dinucleotide containing a triazole moiety, phosphorothiolate cap, biotinylated cap, cap analog containing N1 modification, cap analog containing N2 modification, dinucleotide containing fluorescence probe and TAT, bacterial caps, and trinucleotide cap analogs. In addition, the biological applications of these novel cap analogs are delineated.

show abstract

“…Dinucleotide cap analogs have also been investigated as small molecule inhibitors of cap-dependent translation, which could counteract elevated eIF4E levels in cancer cells [10][11][12][13][14]. Recently, we showed that conjugating dinucleotide cap analogs with transporting vehicles produces cell permeable compounds that induce apoptosis of cancer cells [15].…”

Section: Introductionmentioning

confidence: 99%

Novel N7-Arylmethyl Substituted Dinucleotide mRNA 5′ cap Analogs: Synthesis and Evaluation as Modulators of Translation

et al. 2021

Self Cite

View full text Add to dashboard Cite

Dinucleotide analogs of the messenger RNA cap (m7GpppN) are useful research tools and have potential applications as translational inhibitors or reagents for modification of in vitro transcribed mRNAs. It has been previously reported that replacing the methyl group at the N7-position with benzyl (Bn) produces a dinucleotide cap with superior properties. Here, we followed up on this finding by synthesizing 17 novel Bn7GpppG analogs and determining their structure–activity relationship regarding translation and translational inhibition. The compounds were prepared in two steps, including selective N7-alkylation of guanosine 5′-monophosphate by arylmethyl bromide followed by coupling with imidazole-activated GDP, with total yields varying from 22% to 62%. The compounds were then evaluated by determining their affinity for eukaryotic translation initiation factor 4E (eIF4E), testing their susceptibility to decapping pyrophosphatase, DcpS—which is most likely the major cellular enzyme targeting this type of compound—and determining their translation inhibitory properties in vitro. We also synthesized mRNAs capped with the evaluated compounds and tested their translational properties in A549 cells. Our studies identified N7-(4-halogenbenzyl) substituents as promising modifications in the contexts of either mRNA translation or translational inhibition. Finally, to gain more insight into the consequences at the molecular level of N7-benzylation of the mRNA cap, we determined the crystal structures of three compounds with eIF4E.

show abstract

Exploring the potential of phosphotriazole 5′ mRNA cap analogues as efficient translation initiators

Cited by 13 publications

References 22 publications

The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5’ cap modulates protein expression in living cells

The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5’ cap modulates protein expression in living cells

Recent Advances in Modified Cap Analogs: Synthesis, Biochemical Properties, and mRNA Based Vaccines

Novel N7-Arylmethyl Substituted Dinucleotide mRNA 5′ cap Analogs: Synthesis and Evaluation as Modulators of Translation

Contact Info

Product

Resources

About