2011
DOI: 10.1590/s1415-47572011000400028
| View full text |Cite
|
Sign up to set email alerts
|

Abstract: The applicability of mitochondrial nad6 sequences to studies of DNA and population variability in Lepidoptera was tested in four species of economically important moths and one of wild butterflies. The genetic information so obtained was compared to that of cox1 sequences for two species of Lepidoptera. nad6 primers appropriately amplified all the tested DNA targets, the generated data proving to be as informative and suitable in recovering population structures as that of cox1. The proposal is that, to obtain… Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
2

Citation Types

0
4
0

Year Published

2011
2011
2022
2022

Publication Types

Select...
6

Relationship

0
6

Authors

Journals

citations
Cited by 9 publications
(4 citation statements)
references
References 34 publications
0
4
0
Order By: Relevance
“…The analyzed cox1, cox2 and nad6 fragments were of 1486 bp, 682 bp and 501 bp, respectively (GenBank accession numbers: cox1 JN798937–JN799050, cox2 JN799051–JN799151 and nad6 JN109017–JN109038 (Silva-Brandão et al ., in press) and JN799152–JN799250). The mean genetic distance (uncorrected p -distance, Nei & Kumar (2000)) among cox1 haplotypes was 0.001 (0–0.003), 0 (0–0.004) for cox2 , and 0.001 (0–0.006) for nad6 (table 2).…”
Section: Resultsmentioning
confidence: 99%
“…The analyzed cox1, cox2 and nad6 fragments were of 1486 bp, 682 bp and 501 bp, respectively (GenBank accession numbers: cox1 JN798937–JN799050, cox2 JN799051–JN799151 and nad6 JN109017–JN109038 (Silva-Brandão et al ., in press) and JN799152–JN799250). The mean genetic distance (uncorrected p -distance, Nei & Kumar (2000)) among cox1 haplotypes was 0.001 (0–0.003), 0 (0–0.004) for cox2 , and 0.001 (0–0.006) for nad6 (table 2).…”
Section: Resultsmentioning
confidence: 99%
“…Data for specimens are in Table 1 . Specimens 4–11 were not examined and their identification follows that of the authors who performed sequencing studies and analyses ( Peña et al 2010 , Silva-Brandão et al 2011 , Seraphim et al 2014 ). Percent difference and the number of different nucleotides are shown below and above the diagonal in the matrix, respectively, and the length of each sequence segment (bp) used in the analysis is on the diagonal.…”
Section: Resultsmentioning
confidence: 99%
“…1480 bp) and the subunit 6 of the nicotinamide adenine dinucleotide dehydrogenase ( nad6, ca . 500 bp) were amplified using the follow primers combinations: LCO (5′ GGTCAACAAATCATAAAGATATTGG) + HCO (5′ TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al ., 1994) and Jerry (5′ CAACATTTATTTTGATTTTTTGG 3′) + PatII (5′ TCCATTACATATAATCTGCCATATTAG 3′) (Caterino et al ., 2001) for cox1 , and tPro-J10090 (5′ ATCWATAATCTCCAAAATTAT 3′) + ND6-N10624 (5′ GGNCCATAAAAAATATTWGT 3′) (Silva-Brandão et al ., 2011) for nad6 . Reactions were done in a 25 μl final volume using 1 μl of total DNA, 2.0 mM of MgCl 2 , 40 μM of dNTPs, 0.2 μM of each primer, 1 U of GoTaq DNA Polymerase (Promega, Madison, WI, USA), and 10% of 10 × Taq buffer.…”
Section: Methodsmentioning
confidence: 99%
“…The PCR program to amplify cox1 included an initial denaturation step at 95 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 45–47 °C for 30 s, and polymerization at 72 °C for 1.5 min, followed by an extension step at 72 °C for 10 min (Silva-Brandão et al ., 2005). The amplification protocol for nad6 was as follows: an initial denaturation step at 94 °C for 5 min, 35 cycles of denaturation at 94 °C for 45 s, annealing at 45 °C for 45 s, and elongation at 60 °C for 1.5 min, followed by an extension step at 60 °C for 5 min (Silva-Brandão et al ., 2011). Amplicons were purified of primers and deoxynucleotides with ExoSAP-IT (GE Healthcare, Bucks, UK), and then sequenced by ABI Prism BigDye Kit protocol.…”
Section: Methodsmentioning
confidence: 99%