Expedited assessment of terrestrial arthropod diversity by coupling Malaise traps with DNA barcoding

Abstract

Monitoring changes in terrestrial arthropod communities over space and time requires a dramatic increase in the speed and accuracy of processing samples that cannot be achieved with morphological approaches. The combination of DNA barcoding and Malaise traps allows expedited, comprehensive inventories of species abundance whose cost will rapidly decline as high-throughput sequencing technologies advance. Aside from detailing protocols from specimen sorting to data release, this paper describes their use in a survey of arthropod diversity in a national park that examined 21 194 specimens representing 2255 species. These protocols can support arthropod monitoring programs at regional, national, and continental scales.

A DNA barcode library for 5,200 German flies and midges (Insecta: Diptera) and its implications for metabarcoding‐based biomonitoring

“…The whole voucher was used for some very small specimens (e.g., ≤1 mm, such as small Cecidomyiidae, Chironomidae and Sciaridae), but replacement vouchers from the same locality were retained. In other cases (vouchers from Malaise traps), DNA was extracted from the whole voucher at the CCDB (Guelph, Canada) using "voucher-recovery" protocols (DeWaard et al, 2019) and the specimens were repatriated to the SNSB-ZSM and ZFMK for identification and curation. DNA extraction plates with the tissue samples were sent to the Canadian Center for DNA Barcoding (CCDB) where they were processed using standard protocols.…”

“…All protocols for DNA extraction, PCR amplifications and Sanger sequencing procedures are available online (ccdb.ca/resources/). All samples were PCR-amplified with a cocktail of standard and modified Folmer primers CLepFolF (5′-ATTCAACCAATCATAAAGATATTGG) and CLepFolR (5′TAAACTTCTGGATGTCCAAAAAATCA) for the barcode fragment (5′ COI; see Hernández-Triana et al, 2014), and the same primers were employed for subsequent bidirectional Sanger sequencing reactions (see also Ivanova, Dewaard, & Hebert, 2006;deWaard, Ivanova, Hajibabaei, & Hebert, 2008, DeWaard et al, 2019. Voucher information such as locality data, habitat, altitude, collector, identifier, taxonomic classifications, habitus images, DNA barcode sequences, primer pairs and trace files for 40,753 specimens are publicly accessible in the "DS-DIPBFGBL-A DNA Barcode reference library of German Diptera (BFB-Barcoding Fauna Bavarica & GBOL-German Barcode of Life" data set on BOLD (http://www.bolds ystems.org -data set DOI: dx.doi.org/10.5883/ DS-DIPBFGBL), whereas 4,420 specimen records will be stored in the private data set "DS-DIPBFGBP-A DNA Barcode reference library of German Diptera (BFB-Barcoding Fauna Bavarica & GBOL-German Barcode of Life)-private records for future publication" for subsequent publication by the authors and associated taxonomists.…”

A DNA Barcoding Survey of an Arctic Arthropod Community: Implications for Future Monitoring

“…Collection materials were accessioned and processed at the CBG, following the single-specimen barcoding workflows outlined in deWaard et al [33], with exceptions, as described below. Because the goal of the project was to create a DNA barcode reference library for future monitoring, bulk sample (lot) sorting was prioritized to maximize taxonomic diversity, while reducing the number of replicates per species through initial morphotaxonomic screening.…”

DNA barcodes reveal 63 overlooked species of Canadian beetles (Insecta, Coleoptera)

“…DNA extraction, PCR amplification, and Sanger sequencing of the COI barcode region were performed for all specimens at the Centre for Biodiversity Genomics, using standard protocols optimized for large-scale generation of COI barcode data. For detailed descriptions of the protocols, see Ivanova et al (2006) and deWaard et al (2008deWaard et al ( , 2018. For most specimens, a cocktail of the Folmer primers (Folmer et al 1994) and LepF1 & LepR1 (Hebert et al 2004) was used in the first PCR amplification attempt.…”