Expanding the Range of CRISPR/Cas9 Genome Editing in Rice

Hu, Xixun; Chün, Wang; Fu, Yaping; Liu, Qing; Jiao, Xiaozhen

doi:10.1016/j.molp.2016.03.003

Cited by 105 publications

(58 citation statements)

References 10 publications

(16 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The OsFLN1RNAi vector was introduced into NPB via A. tumefaciens ‐mediated transformation as described by Toki et al (). Targeted deletion vectors were constructed in the CRISPR/Cas9 system (Hu et al ), using the respective target sequences, GAGGTCAAGGGATGAAACAA for OsFLN1 and GATTTCTACGCGACGTGGTG for OsTRXz , and introduced into NPB via A. tumefaciens ‐mediated transformation.…”

Section: Methodsmentioning

confidence: 99%

FRUCTOKINASE‐LIKE PROTEIN 1 interacts with TRXz to regulate chloroplast development in rice

Zhang

Qiu

et al. 2018

JIPB

View full text Add to dashboard Cite

Chloroplast genes are transcribed by the plastid-encoded RNA polymerase (PEP) or nucleus-encoded RNA polymerase. FRUCTOKINASE-LIKE PROTEINS (FLNs) are phosphofructokinase-B (PfkB)-type carbohydrate kinases that act as part of the PEP complex; however, the molecular mechanisms underlying FLN activity in rice remain elusive. Previously, we identified and characterized a heat-stress sensitive albino (hsa1) mutant in rice. Map-based cloning revealed that HSA1 encodes a putative OsFLN2. Here, we further demonstrated that knockdown or knockout of the OsFLN1, a close homolog of HSA1/OsFLN2, considerably inhibits chloroplast biogenesis and the fln1 knockout mutants, created by clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associate protein 9, exhibit severe albino phenotype and seedling lethality. Moreover, OsFLN1 localizes to the chloroplast. Yeast two-hybrid, pull-down and bimolecular fluorescence complementation experiments revealed that OsFLN1 and HSA1/OsFLN2 interact with THIOREDOXINZ (OsTRXz) to regulate chloroplast development. In agreement with this, knockout of OsTRXz resulted in a similar albino and seedling lethality phenotype to that of the fln1 mutants. Quantitative reverse transcription polymerase chain reaction and immunoblot analysis revealed that the transcription and translation of PEP-dependent genes were strongly inhibited in fln1 and trxz mutants, indicating that loss of OsFLN1, HSA1/OsFLN2, or OsTRXz function perturbs the stability of the transcriptionally active chromosome complex and PEP activity. These results show that OsFLN1 and HSA1/OsFLN2 contribute to chloroplast biogenesis and plant growth.

show abstract

Section: Methodsmentioning

confidence: 99%

FRUCTOKINASE‐LIKE PROTEIN 1 interacts with TRXz to regulate chloroplast development in rice

Zhang

Qiu

et al. 2018

JIPB

View full text Add to dashboard Cite

show abstract

“…These features are shared with other cereals such as wheat and barley, and it may be challenging to develop unique target sites for the majority of genes in these species, although genome editing using CRISPR/Cas9 has been successful in all three cereals (Lawrenson et al ., ; Svitashev et al ., ; Upadhyay et al ., ). Cas9 variants, such as the abovementioned Sp Cas9 VQR and VRER mutants that recognize noncanonical PAMs, can broaden the range of genome editing; that is, they approximately double the number of accessible sites in rice compared to wild‐type Sp Cas9 and may therefore facilitate the editing of more complex plant genomes (Hu et al ., ).…”

Section: Selection Of Target Sites In Different Speciesmentioning

confidence: 97%

Patterns of CRISPR/Cas9 activity in plants, animals and microbes

Bortesi

Zhu

Zischewski

et al. 2016

Plant Biotechnology Journal

119

View full text Add to dashboard Cite

SummaryThe CRISPR/Cas9 system and related RNA‐guided endonucleases can introduce double‐strand breaks (DSBs) at specific sites in the genome, allowing the generation of targeted mutations in one or more genes as well as more complex genomic rearrangements. Modifications of the canonical CRISPR/Cas9 system from Streptococcus pyogenes and the introduction of related systems from other bacteria have increased the diversity of genomic sites that can be targeted, providing greater control over the resolution of DSBs, the targeting efficiency (frequency of on‐target mutations), the targeting accuracy (likelihood of off‐target mutations) and the type of mutations that are induced. Although much is now known about the principles of CRISPR/Cas9 genome editing, the likelihood of different outcomes is species‐dependent and there have been few comparative studies looking at the basis of such diversity. Here we critically analyse the activity of CRISPR/Cas9 and related systems in different plant species and compare the outcomes in animals and microbes to draw broad conclusions about the design principles required for effective genome editing in different organisms. These principles will be important for the commercial development of crops, farm animals, animal disease models and novel microbial strains using CRISPR/Cas9 and other genome‐editing tools.

show abstract

“…d). As expected, both T 0 rice lines displayed narrower leaves than the wild‐type (Figs e, e), resembling the reported nal1 null phenotype (Hu et al ., ). These results suggested that multiple gene knockout in rice can be efficiently achieved in the T 0 generation through base‐editor‐induced mRNA missplicing.…”

Section: Resultsmentioning

confidence: 97%

Gene disruption through base editing‐induced messenger RNA missplicing in plants

Xiong

Wang

et al. 2019

New Phytologist

View full text Add to dashboard Cite

Summary Gene knockout tools are highly desirable for basic and applied plant research. Here, we leverage the Cas9‐derived cytosine base editor to introduce precise C‐to‐T mutations to disrupt the highly conserved intron donor site GT or acceptor site AG, thereby inducing messenger RNA (mRNA) missplicing and gene disruption. As proof of concept, we successfully obtained Arabidopsis null mutant of MTA gene in the T2 generation and rice double null mutant of GL1‐1 and NAL1 genes in the T0 generation by this strategy. Elimination of the original intron donor site or acceptor site could trigger aberrant splicing at a new specific exonic site, but not at the closest GT or AG site, suggesting cryptic rules governing splice site recognition. The strategy presented expands the applications of base editing technologies in plants by providing a new means for gene inactivation without generating DNA double‐strand breaks, and it can potentially serve as a useful tool for studying the biology of mRNA splicing.

show abstract

Expanding the Range of CRISPR/Cas9 Genome Editing in Rice

Cited by 105 publications

References 10 publications

FRUCTOKINASE‐LIKE PROTEIN 1 interacts with TRXz to regulate chloroplast development in rice

FRUCTOKINASE‐LIKE PROTEIN 1 interacts with TRXz to regulate chloroplast development in rice

Patterns of CRISPR/Cas9 activity in plants, animals and microbes

Gene disruption through base editing‐induced messenger RNA missplicing in plants

Contact Info

Product

Resources

About