Exogenous Activation of BMP‐2 Signaling Overcomes TGFβ‐Mediated Inhibition of Osteogenesis in Marfan Embryonic Stem Cells and Marfan Patient‐Specific Induced Pluripotent Stem Cells

Abstract

Marfan syndrome (MFS) is a hereditary disease caused by mutations in the gene encoding Fibrillin-1 (FBN1) and characterized by a number of skeletal abnormalities, aortic root dilatation, and sometimes ectopia lentis. Although the molecular pathogenesis of MFS was attributed initially to a structural weakness of the fibrillin-rich microfibrils within the extracellular matrix, more recent results have documented that many of the pathogenic abnormalities in MFS are the result of alterations in TGFb signaling. Mutations in FBN1 are therefore associated with increased activity and bioavailability of TGF-b1, which is suspected to be the basis for phenotypical similarities of FBN1 mutations in MFS and mutations in the receptors for TGFb in Marfan syndrome-related diseases. We have previously demonstrated that unique skeletal phenotypes observed in human embryonic stem cells carrying the monogenic FBN1 mutation (MFS cells) are faithfully phenocopied by cells differentiated from induced pluripotent-stem cells (MFSiPS) derived independently from MFS patient fibroblasts. In this study, we aimed to determine further the biochemical features of transducing signaling(s) in MFS stem cells and MFSiPS cells highlighting a crosstalk between TGFb and BMP signaling. Our results revealed that enhanced activation of TGFb signaling observed in MFS cells decreased their endogenous BMP signaling. Moreover, exogenous BMP antagonized the enhanced TGFb signaling in both MFS stem cells and MFSiPS cells therefore, rescuing their ability to undergo osteogenic differentiation. This study advances our understanding of molecular mechanisms underlying the pathogenesis of bone loss/abnormal skeletogenesis in human diseases caused by mutations in FBN1.

Transdifferentiation of alveolar epithelial type II to type I cells is controlled by opposing TGF-β and BMP signaling

“…It also, as shown in the current study, inhibits BMP signaling. For instance, competing TGF-␤ and BMP signaling controls hair follicle stem cell activation, and embryonic stem cells derived from humans with Marfan syndrome support this concept (35,36). In more specialized cell types such as pulmonary myofibroblastic cells and pulmonary artery smooth muscle cells, it has been also observed that perturbation of BMP signaling leads to alteration of TGF-␤ signaling in an opposite direction (25,33).…”

Small Molecule Inhibition of Transforming Growth Factor Beta Signaling Enables the Endogenous Regenerative Potential of the Mammalian Calvarium

“…46 RNA isolation, reverse transcription, and quantitative real time polymerase chain reaction Total RNA isolation, reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), primers sequence for mouse and human Runx2, Bglap, and Gapdh, and annealing temperature were previously described. 11,13,47 Specific primers for Bmp2 and Smad6 and Id2 were designed based on their GenBank sequence, and sequences are as follows: mSmad6Fwd:TACCACTTCAGCCGGCCTCTG; mSmad6Rev:AGTACGCCACGCTGCACCAGT; mBmp2Fwd: ACCCGCTGTCTTCTAGTGTTG; mBmp2Rev:TCTCTGC TTCAGGCCAAACA; mId2Fwd:GATGATCGTCTTGCCC AGGT; mId2Rev:TCTGGTATTCACGCTCCACC annealing at 57°C. hSMAD6Fwd:CCCCCGGCTACTCCATCAA GGTGT; hSMAD6Rev:GTCCGTGGGGGCTGTGTCTCTGG; annealing at 65°C.…”

The role of transforming growth factor-beta in Marfan syndrome

“…High interstitial concentration of TGF-b is also responsible for reduced muscle mass, characteristic to Marfanoid habitus as TGF-b hinders mitosis and differentiation of satellite cells which are important in the development of muscle fi bres [31]. Moreover, a high TGF-b level inhibits the fusion of satellite cells [31] and the downstream signalling pathways of endogenous bone morphogenetic protein 2 (BMP-2) in human stem cells, which is indispensable for bone and cartilage development [32]. Because of this interaction between BMP-2 and TGF-b, the high availability of the latter molecule may be responsible for the tall stature of Marfan patients and other Marfanoid features [32].…”

“…Moreover, a high TGF-b level inhibits the fusion of satellite cells [31] and the downstream signalling pathways of endogenous bone morphogenetic protein 2 (BMP-2) in human stem cells, which is indispensable for bone and cartilage development [32]. Because of this interaction between BMP-2 and TGF-b, the high availability of the latter molecule may be responsible for the tall stature of Marfan patients and other Marfanoid features [32].…”