Evolutionary origin of Ceratonova shasta and phylogeny of the marine myxosporean lineage

Fiala, Ivan; Hlavničková, Marie; Kodádková, Alena; Freeman, Mark; Bartošová-Sojková, Pavla; Atkinson, Stephen D.

doi:10.1016/j.ympev.2015.03.004

Cited by 53 publications

(39 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The SS rRNA gene of C. amazonensis n. sp. was amplified as described by Fiala et al (2015), with universal eukaryotic primers ERIB1 (ACCTGGTTGATCCTGCCAG; Barta et al 1997) with ERIB10 (CTTCCGCAGGTTCACCTACGG; Barta et al 1997). The amplification was performed in the Mastercycler® nexus (Eppendorf, Hamburg, Germany), with an initial denaturation step at 95°C for 5 min, followed by 35 denaturation cycles at 95°C for 60 s, annealing at 60°C for 60 s, and extension at 72°C for 120 s, following by a terminal extension at 72°C for 5 min.…”

Section: Methodsmentioning

confidence: 99%

“…In this myxosporean fauna, the number of species belonging to the genus Ceratomyxa is restrict to four, and only Ceratomyxa microlepis Azevedo, Rocha, Casal, São-Clemente, Matos, Al-Quraishy & Matos, 2013, parasite of Amazonian Hemiodus microlepis, has been reported in freshwater fish (Azevedo et al 2013). In this context, while numerous small subunit (SS) rDNA sequences are available to marine Ceratomyxa species worldwide, there exist no available data about species from freshwater fishes (Fiala et al 2015), making it impossible to understand their evolutionary history in the context of the marine lineage.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon

et al. 2016

View full text Add to dashboard Cite

The specious genus Ceratomyxa Thélodan, 1892, infect mainly gallbladder of marine fishes, with only five species reported infecting species from freshwater environment. This study performed morphological and phylogenetic analyses involving a new Ceratomyxa species (Ceratomyxa amazonensis n. sp.) found in gallbladder of Symphysodon discus Heckel, 1840 (Perciformes: Cichlidae), an important ornamental fish endemic to Amazon basin. Mature spores were strongly arcuate shaped and measured 7.0 ± 0.3 (6.2-7.6) μm in length, 15.8 ± 0.4 (15.0-16.7) μm in thickness, and polar capsules 3.22 ± 0.34 (2.4-3.6) μm in length and 2.63 ± 0.17 (2.4-2.9) μm in width. This was the first small subunit ribosomal DNA (SS rDNA) sequencing performed to Ceratomyxa species parasite of freshwater fish, and the phylogenetic analysis showed C. amazonensis n. sp. clustering in the early diverging subclade of the ceratomyxids, together with species of parasites of amphidromous/estuaries fishes, suggesting some role of the transition of the fishes between marine/freshwater environments in the evolutionary history of these parasites.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Recently, a large phylogenetic reconstruction of Ceratomyxa resulted in distinction of five subclades (Fiala et al 2015). The newly identified species clusters within subclade E of Fiala et al (2015), which contains the highest number of species analysed.…”

Section: Discussionmentioning

confidence: 98%

“…All Ceratomyxa species with known SSU rDNA sequences cluster in the single large clade within the marine myxosporean lineage (Gunter et al 2009, Fiala et al 2015. Although this clade contains more than 70 species of Ceratomyxa, the presence of Palliatus indecorus Shulman, Kovaleva et Dubina, 1979 and Myxodavisia bulani Fiala, Hlavničková, Kodádková, Freeman, Bartošová-Sojková et Atkinson, 2015 caused the paraphyletic character of the Ceratomyxa clade (Fiala et al 2015, Rocha et al 2015.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Ceratomyxa bohari sp. n. (Myxozoa: Ceratomyxidae) from the gall bladder of Lutjanus bohar Forsskal from the Red Sea coast off Saudi Arabia: morphology, seasonality and SSU rDNA sequence

et al. 2016

View full text Add to dashboard Cite

Abstract:A new myxozoan, Ceratomyxa bohari sp. n., infecting the gall bladder of two-spot red snapper, Lutjanus bohar Forsskål, in the Red Sea off Saudi Arabia, is described using light microscopy and characterised genetically. The infection was recorded as mature spores floating free in the bile. The overall prevalence of infection of the type host was 19% (67 fish infected of 360 examined), with the highest prevalence in autumn (31%; 28/90) and the lowest in winter at 12% (11/90). Mature spores are slender and slightly crescent-shaped in the frontal view, with anterior and posterior margins tapered gradually to rounded valvular tips. Spore valves are unequal with a prominent sutural line. The spore dimensions are 3-4 μm (mean 3.5 μm) in length and 16-19 μm (mean 17 μm) in thickness. Two polar capsules are spherical, equal in size, 1.5 μm in diameter. Coils of the polar filament are indiscernible. The sporoplasm is binucleated and fills nearly one third of the extracapsular space restricted to the area below the capsules. The molecular analysis based on the small subunit rDNA (SSU rDNA) sequence revealed a close relationship with majority of species of Ceratomyxa Thélohan, 1892 and phylogenetic clustering with species from different geographical location. Thus, the shorter spore of the present Ceratomyxa species and the divergence of the SSU rDNA sequences were the distinctive features that separate it from all previously described species and identified this parasite as a new species of Ceratomyxa.

show abstract

Myxozoan and Coccidial Diseases

Hadfield

2021

Clinical Guide to Fish Medicine

View full text Add to dashboard Cite

Evolutionary origin of Ceratonova shasta and phylogeny of the marine myxosporean lineage

Cited by 53 publications

References 60 publications

Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon

Morphology and small subunit rDNA-based phylogeny of Ceratomyxa amazonensis n. sp. parasite of Symphysodon discus, an ornamental freshwater fish from Amazon

Ceratomyxa bohari sp. n. (Myxozoa: Ceratomyxidae) from the gall bladder of Lutjanus bohar Forsskal from the Red Sea coast off Saudi Arabia: morphology, seasonality and SSU rDNA sequence

Myxozoan and Coccidial Diseases

Contact Info

Product

Resources

About