Evolutionary and developmental analysis reveals KANK genes were co-opted for vertebrate vascular development

Hensley, Monica R.; Cui, Zelin; Chua, Rhys; Simpson, S.L.; Shammas, Nicole L.; Yang, Jer-Yen; Leung, Yiu-Wing; Zhang, Guangjun

doi:10.1038/srep27816

Cited by 19 publications

(31 citation statements)

References 61 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The collected fish embryos were fixed with 4% paraformaldehyde overnight at 4° and then dehydrated using increasing concentrations of methanol (25, 50, 75, and 100%) in PBS with 0.1% Tween-20, and stored at −20°. Whole-mount in situ hybridizations were carried out according to previously published methods ( Thisse and Thisse 2008 ; Hensley et al 2016 ). Color reactions were carried out in alkaline phosphatase buffer (NTMT) solution (100 mM Tris-HCl pH 9.5, 50 mM MgCl 2 , 100 mM NaCl, 0.1% Triton-X, and 1 mM levamisole) with 75 mg/ml nitrotetrazolium blue (NBT) (Roche), 50 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate p-toluidine) (Roche), and 10% DMF (N,N-dimethylformamide).…”

Section: Methodsmentioning

confidence: 99%

Potassium Channel-Associated Bioelectricity of the Dermomyotome Determines Fin Patterning in Zebrafish

Silic

Kim

et al. 2020

Genetics

Self Cite

View full text Add to dashboard Cite

The roles of bioelectric signaling in developmental patterning remain largely unknown, although recent work has implicated bioelectric signals in cellular processes such as proliferation and migration. Here, we report a mutation in the inwardly rectifying potassium channel (kir) gene, kcnj13/kir7.1, that causes elongation of the fins in the zebrafish insertional mutant Dhi2059. A viral DNA insertion into the noncoding region of kcnj13 results in transient activation and ectopic expression of kcnj13 in the dermomyotome, from which the fin ray progenitors originate. We made an allele-specific loss-of-function kcnj13 CRISPR mutant and showed that it could reverse the long-finned phenotype, but only when located on the same chromosome as the Dhi2059 viral insertion. Also, we showed that ectopic expression of kcnj13 in the dermomyotome of transgenic zebrafish produces phenocopies of the Dhi2059 mutant in a gene dosage-sensitive manner. Finally, to determine whether this developmental function is specific to kcnj13, we ectopically expressed three additional potassium channel genes, kcnj1b, kcnj10a, and kcnk9. We found that all induce the long-finned phenotype, indicating that this function is conserved among potassium channel genes. Taken together, our results suggest that dermomyotome bioelectricity is a new fin patterning mechanism, and we propose a two-stage bioelectricity model for zebrafish fin patterning. This ion-channel-regulated bioelectric developmental patterning mechanism may provide us new insight into vertebrate morphological evolution and human congenital malformations.

show abstract

Section: Methodsmentioning

confidence: 99%

Potassium Channel-Associated Bioelectricity of the Dermomyotome Determines Fin Patterning in Zebrafish

Silic

Kim

et al. 2020

Genetics

Self Cite

View full text Add to dashboard Cite

show abstract

“…WGD occurred around the origin of vertebrate lineage, has been shown to be related to vertebrate morphological innovations ( Manzanares et al, 2000 ; True and Carroll, 2002 ). For example, the origin of vertebrate cartilage was found to be attributable to the duplication of chordate fibrillar collagen genes ( Wada et al, 2006 ; Zhang et al, 2006 ), and the emergence of vertebrate vascular vessels to the duplication of kank genes ( Hensley et al, 2016 ).…”

Section: Introductionmentioning

confidence: 99%

Evolutionary and Expression Analyses Show Co-option of khdrbs Genes for Origin of Vertebrate Brain

Yang

Wang

et al. 2018

Front. Genet.

View full text Add to dashboard Cite

Genes generated by whole genome duplications (WGD) can be co-opted by changing their regulation process or altering their coding proteins, which has been shown contributable to the emergence of vertebrate morphological novelties such as vertebrate cartilage. Mouse khdrbs genes, differing from its invertebrate orthologs, were mainly expressed in brain, hinting that khdrbs gene family as a member of genetic toolkit may be linked to vertebrate brain development. However, the evolutionary relationship between khdrbs gene family and vertebrate brain development is unclear. First, we analyzed the evolutionary history of khdrbs gene family in metazoans, and then investigated their expression patterns during early development and in adulthood of zebrafish. We found that the duplication of khdrbs gene family by WGD took place in zebrafish, and all zebrafish khdrbs genes were predominantly expressed in the substructures of brain during early development. Given the expression of invertebrate khdrbs gene in germ line, the distinct expression domains of zebrafish khdrbs genes in brain suggested that the duplicated khdrbs genes are co-opted for promoting the evolutionary origin of vertebrate brain.

show abstract

“…The primers Dr.reck-97F (5' CACCATGAGCGGGTGTCTCCAGATCCTCA3') and Dr.reck-2961R (5' GAGGTCAGAGGTCAGGGTCAGGAT3') were used for the zebrafish reck gene cloning PCR. The zebrafish reck gene cloning and In Situ hybridization were performed using the standard methods as previously described [ 67 ].…”

Section: Methodsmentioning

confidence: 99%

Identification of RECK as an evolutionarily conserved tumor suppressor gene for zebrafish malignant peripheral nerve sheath tumors

et al. 2018

Self Cite

View full text Add to dashboard Cite

Malignant peripheral nerve sheath tumors (MPNSTs) are a type of sarcoma with poor prognosis due to their complex genetic changes, invasive growth, and insensitivity to chemo- and radiotherapies. One of the most frequently lost chromosome arms in human MPNSTs is chromosome 9p. However, the cancer driver genes located on it remain largely unknown, except the tumor suppressor gene, p16 (INK4)/CDKN2A. Previously, we identified RECK as a tumor suppressor gene candidate on chromosome 9p using zebrafish-human comparative oncogenomics. In this study, we investigated the tumorigenesis of the reck gene using zebrafish genetic models in both tp53 and ribosomal protein gene mutation background. We also examined the biological effects of RECK gene restoration in human MPNST cell lines. These results provide the first genetic evidence that reck is a bona fide tumor suppressor gene for MPNSTs in zebrafish. In addition, restoration of the RECK gene in human MPNST cells leads to growth inhibition suggesting that the reactivation of RECK could serve as a potential therapeutic strategy for MPNSTs.

show abstract

Evolutionary and developmental analysis reveals KANK genes were co-opted for vertebrate vascular development

Cited by 19 publications

References 61 publications

Potassium Channel-Associated Bioelectricity of the Dermomyotome Determines Fin Patterning in Zebrafish

Potassium Channel-Associated Bioelectricity of the Dermomyotome Determines Fin Patterning in Zebrafish

Evolutionary and Expression Analyses Show Co-option of khdrbs Genes for Origin of Vertebrate Brain

Identification of RECK as an evolutionarily conserved tumor suppressor gene for zebrafish malignant peripheral nerve sheath tumors

Contact Info

Product

Resources

About